Skip to main content

Table 2 The oligonucleotide primer used for construction of GPV RC16 infectious clone in this study

From: The 164 K, 165 K, and 167 K residues of VP1 are vital for goose parvovirus proliferation in GEFs based on PCR-based reverse genetics system

PrimerThe sequence (5′-3′)
pACA1FGCCAGTATACACTCCGCTAGCTCATTGGAGGGTTCG
pACA1RTCGATACCGTCGACCTCGAGCATGCGCGCGGTCAAC
pACA2FGTTAGGTTGACCGCGCGCATGCGCGCGGTCAGCCC
pACA2R)CAGGAATTCGATATCAAGCTTCTTCCTGGCGCGCAAAATATC
pACA3FGATATTTTGCGCGCCAGGAAGTGACGTGCAATGCCAC
pACA3RCAGGAATTCGATATCAAGCTTCTACCGGGTAGTGGTC
pACA4FAAAGCTGGAGCCCCTCACCCAAAACCAAACCAGCAGACTCAG
pACA4RTGGCAAAGTGGATCCCCCGGGCTGCAGGAATTCCTAAAATATTTTGGGC
pACA5FCCAGCCCAAAATATTTTAGGTTTAGCTAAAGATC
pACA5RTGGCAAAGTGGATCCCCCGGGCATGTGGAGCTCCAGCCCAATAGTTAAG
pACA6FCTTAACTATTGGGCTGGACCGCGCGCATGCG
pACA6RATGGCAAAGTGGATCCCCCGGGTCATTGGAGGGTTCGTTCG
  1. The region of plasmid vector was indicated by underline