Skip to main content

Table 1 The oligonucleotide primer used for amplification of GPV RC16 genome in this study

From: The 164 K, 165 K, and 167 K residues of VP1 are vital for goose parvovirus proliferation in GEFs based on PCR-based reverse genetics system

PrimerThe sequence (5′-3′)
A1FTCATTGGAGGGTTCGTTCGTTC
A1RCATGCGCGCGGTCAACCTAACAGCCG
A2FCGCGCGGTCAGCCCAATAGTTAAGCC
A2RCTTCCTGGCGCGCAAAATATC
A3FGATATTTTGCGCGCCAGGAAG
A3RGAGGGGCTCCAGCTTTCAGATTCC
A4FCGGAATCTGAAAGCTGGAGC
A4RCTAAAATATTTTGGGCTGGGATGC
A5FTCAGCTACTCACACAGAAG
A5RCATGCGCGCGGTCAGCCCAATAG
A6FCGCGCGGTCAACCTAACAGCCGG
A6R(A1F)TCATTGGAGGGTTCGTTCGTTC