Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers used for construction of D51 infectious clone

From: A novel method to rescue and culture duck Astrovirus type 1 in vitro

Primer Sequences(5′-3′)
HeadRiboF1 TTGGCGCGCCACATCATCTGATGAGTCCGTGAGGACGAAACGGTACCCG (Asc I)
HeadRiboF2 CGTGAGGACGAAACGGTACCCGGTACCGTCATCCGAAGTGGGCGAGTCGGGGCCATGGC
F1-R CCAGGTGTCAACAATCATGC
Long-7R CCAGAACATTGTCTTTATTCCCTGTAATCTGTCCAAGTGTGACCACTGTTGTC
Long-8F AGGTGCAGGGTCCCCCTGTCAATGATAAAATGACAACAGTGGTCACACTTGGA
aR CGCGGATCCTTTGGATACGCTGGTGTTG (BamH I)
bF CAGAGAATGCTTGATGAAGGC
bR CGCGGATCCGTTGAAAACTGCCCTGAAGG (BamH I)
cF CTTGGACTGTGGAAGCATATACC
cR CGCGGATCCTCATGTGTGGTGTATACTGTGATG (BamH I)
dF GACAACAGTGGTCACACTTGGA
F12-F ACAGCTGCACTTTCTCATGC
HpaR1 CCGCTCGAGGTCCCATTCGCCATTACCGAGGGGACGGTCCCCTCGGAATGTTGCCCAGCCG (Xho I)
HpaR2 CGGAATGTTGCCCAGCCGGCGCCAGCGAGGAGGCTGGGACCATGCCGGCCTTTT
HpaR3 GGACCATGCCGGCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATGCCAATTGAA
Marker1 AGCTGGATGTCTGTATTTCGGTTCAACAGCCTCCAGATCTCTCAACAGCGCAC (Bgl II)
Marker2 GCTGTTGTGGTGAAGATCAGTGGTGCGCTGTTGAGAGATCTGGAGGCTGTTGAACC (Bgl II)
  1. Underlined nucleotides represented the restriction sites