Skip to main content

Table 1 Primers used for complete genome sequencing of D51 strain

From: A novel method to rescue and culture duck Astrovirus type 1 in vitro

Primer Sequence Localization (in the polyprotein gene) Fragment length (bp)
1F CCGAA(G/A)TGGGCGAGTC 1–918 919
1R CCAGGTGTCAACAATCATGC
2F GATGTTTATGGTGAGTTGTACAC(A/T)G 806–1786 972
2R GCTAGATGGTATTATGCCTCTTG
3F TTGCAGCTCACTCTGGCATA 1567–2231 666
3R TGATGTCACTCCCTGTGAA(G/C)C
4F CTCGCGAAAGAAGTTAAGAGTG 2021–2989 971
4R CCTTCTTCATCGATGTCATTATCC
5F CAGAGAATGCTTGATGAAGG(C/T) 2879–4177 1297
5R TT(T/A)GGATACGCTGGTGTTGA
6F CTTGGACTGTGGAAGCATATACC 3977–4740 763
6R GTTGAAAACTGCCCTGAAGG
7F GTTACCAACTGGAGAAGTCTGTCA 4680–5582 903
7R TCCAAGTGTGACCACTGTTGTC
8F GACAACAGTGGTCACACTTGGA 5561–6619 1082
8R CCATGTGTGGTGTATATTGTGAT(G/A)
9F GAGGTGTTCTGGGCAGTTTCAA 6291–7403 1113
9R CTCCATCATCATCCTCTCACACTG
10F AGTGTGAGAGGATGATGATGGA 7381–7620 240
10R TGTGACCCACATGGTGATTTC
3′ Race P1 AGTGTGAGAGGATGATGATGGA 7381–7751 371
Race1 GACTCGAGTCGACATCGA(T)18
P2 ACAGCTGCACTTTCTCATGC 7516–7751 236
Race2 GACTCGAGTCGACATCGA