Skip to main content

Advertisement

Table 1 Primers used for amplification of Core and NS5B regions

From: Hepatitis C virus genotyping based on Core and NS5B regions in Cameroonian patients

Genomic regions Primers Sequences (5′------3′)
Core Core OS (outer f) ACTGCCTGATAGGGTGCTTGCGAG
Core OAS (outer r) ATGTACCCCATGAGGTCGGC
Core IS (inner f) AGGTCTCGTAGACCGTGCATCATG
Core IAS (inner r) CAYGTRAGGGTATCGATGAC
NS5B SO755 (outer and inner f) TATGAYACCCGCTGYTTTGACTC
ASO1121 (outer r) GCNGARTAYCTVGTCATAGCCTC
ENO2BIS (inner r) GCTAGTCATAGCCTCCTG
  1. f, forward and r, reverse. The modifications from the primer sequences described by Lole et al. [23] are underlined