Skip to main content

Advertisement

Table 1 List of primers used in this study

From: Generation of recombinant MVA-norovirus: a comparison study of bacterial artificial chromosome- and marker-based systems

Primer Sequence 5′ → 3´ Description
Kan control F: CGTACTCCTGATGATGCATG R: ATTCGTGATTGCGCCTGAGC For control PCR/sequencing after first recombination into MVA-BAC
MVA DelIII F: GATGAGTGTAGATGCTGTTATTTTG R: GCAGCTAAAAGAATAATGGAATTG To check the presence of WT and gene insertion after plaque picking
MVA DelVI F: CTCCGCATCTAGTTGATATTCCAACCTCTT R: CCTGGACATTTAGTTTGAGTGTTCCTGAAT For first homologous recombination into the MVA-BAC by En-passant
pEPH5-GII4 F: CATAAATAAGGTTGACTCTAGAGCCACCATGAAGATGGCCTC R: ACGTAGAGCTCTTAAGGAATTCTTATACGGCTCGTCTTCTACCT For cloning of NoV GII.4 into pEP-MVAdVI-PH5 plasmid
pIIIH5-GII.4 F: TAAGGTTGACTCTAGAGCTAGCGCCACCATGAAGATGGCCTC R: CGGCCGCGTTTAAACCTCGAGTTATACGGCTCGTCTTCTACCT For cloning of NoV GII.4 into the pIIIH5 shuttle vector
RFV F: AAAGATGCGTACATTGGACCC R: GTTCGAGACTAGAAAAGCGCC To check the presence of helper virus RFV in the transfect cells with recMVA-BAC