Skip to main content

Advertisement

Table 2 Primers used in the quantitative real-time PCR

From: Porcine transmissible gastroenteritis virus inhibits NF-κB activity via nonstructural protein 3 to evade host immune system

Gene names Forward primer sequences (5′-3′) Reverse primer sequences (5′-3′)
IL-1 AGGGACATGGAGAAGCCATTT TTCTCCTTGAGAGCTGATG
IL-6 AAATGCTCTTCACCTCTC TCACACTTCTCATACTTCTC
IL-8 GTTCTGGCAAGAGTAAG CACGGAGAATGGGTTT
TNF-α CGTTGTAGCCAATGTCAAAGCC TGCCCAGATTCAGCAAAGTCCA
β-actin CCATCGTCCACCGCAAAT CCAAATAAAGCATGCCAATC