Skip to main content

Advertisement

Table 1 The specific primers for Nsp3

From: Porcine transmissible gastroenteritis virus inhibits NF-κB activity via nonstructural protein 3 to evade host immune system

Gene name Primer name Primer sequence (5′-3′) Position (bp)
NSP3–1 Nsp3(1-418aa)-F ACGCGTCGACCGGTGACAAAACTGTCTCATTTTCAG 1–1254
Nsp3(1-418aa)-R CGGCCATGGCTACTCTTTTTCAATAGAGGATTTG
NSP3–2 Nsp3(410-601aa)-F ACGCGTCGACCGCCAATGTAATGACTAGAGCTG 1230–1803
Nsp3(410-601aa)-R CGGCCATGGCTAGCTAGGCAACTGGTTTGTAACATC
NSP3–3 Nsp3(590-1215aa)-F ACGCGTCGACCGTCTTCGTATACACTGACCAGGAG 1770–3645
Nsp3(590-1215aa)-R CGGGGTACCCTA CAGAATTTACCAGTACCATTAGC
NSP3–4 Nsp3(1168-1510aa)-F ACGCGTCGACCCATATTGTTTTCGCATGCTCAAACCCG 3504–4510
Nsp3(1168-1510aa)-R CGGGGTACCCTATGAACCACTTTTTGGAGACACAG
  1. The restriction enzyme cutting sites are highlighted by underline