Skip to main content

Advertisement

Table 1 Primers used for the construction of CA10 infection clones

From: Construction and characterization of an infectious cDNA clone of coxsackievirus A 10

Primer name Sequence (5’–3’)
pSVA-F GTCGACAATTCTCATGTTTGACAGC
pSVA-R CCTATAGTGAGTCGTATTACGCGGC
CA10-F1 GTAATACGACTCACTATAGGTTTAAAACAGCCTGTGGGTTGTACC
CA10-R1 CGCCGAGTCCCTTGATATAGTCAGACACTCCCTG
CA10-F2 CTATATCAAGGGACTCGGCGATGCTTTT
CA10-R2 CAAACATGAGAATTGTCGACTTTTTTTTTTTTTTTTTTTTTTTTTGCTATTC