Skip to main content

Advertisement

Table 1 Real-time PCR primers and probes specifications

From: Association of polymorphisms in inflammatory cytokines encoding genes with severe cases of influenza A/H1N1 and B in an Iranian population

Primers/Probes Sequence (5′ > 3′)
Flu A Forward GACAAAATAACATTCGAAGCAACTGG
Flu A Reverse GGGAGGCTGGTGTTTATAGCACC
Flu A Probea GCATTCGCAA″t″GGAAAGAAATGCTGG
Flu B Forward TCCTCAAYTCACTCTTCGAGCG
Flu B Reverse CGGTGCTCTTGACCAAATTGG
Flu B Probeb CCAATTCGAGCAGCTGAAACTGCGGTG
  1. aTaqMan probes are labeled at 5′- end with FAM and at the 3′- end with BHQ1
  2. bTaqMan probes are labeled at 5′- end with ROX and at 3′- end with BHQ1