Skip to main content

Advertisement

Table 3 Primers and probes used for RAA and tq-PCR

From: Development and evaluation of recombinase-aided amplification assays incorporating competitive internal controls for detection of human adenovirus serotypes 3 and 7

  Primer/probe Sequence (5′ to 3′) Product size (bp) Source
RAA AdV 3-F ATTCCGGCACAGCTTACAATTCACTCGCTCC 184 This paper
  AdV 3-R TCAGTAGTGG TAATGTCTTT CCCAATTTGC  
  AdV 3-Pa ACAATGCAGTAACTACCACCACAAACACA [HEXdT][THF][BHQ-dT]GGCATTGCTTCCAT[C3-spacer]  
  AdV 7-F ACAACGGGAGAAGACAATGCCACCACATACAC 186 Thispaper
  AdV 7-R AdV 7-Pa IC-Pa TCCATCAATATCAGTCCATGATTCTTCTCC AAGACATTACTGCAGACAACAAGCCCATT [HEXdT][THF][BHQ-dT]GCCGATAAAACATAT[C3-spacer] GTAAGGTGCTAGACTAAAATTGTTGGGACTT [FAMdT]G[THF]A[BHQ-dT]CTCTGAAGTAAAAGG[C3-spacer]  
tq-PCR F-primer GGYCCYAGYTTYAARCCCTAYTC   [15]
  R-primer AAYTTGAGGYTCTGGYTGATCKG  
  Probe3 HEX-ACAATGCAGTAACTACCACCACAA-MGB  
  Probe7 Cy5-TTACTGCAGACAACAAGCCCAT-MGB  
  1. aProbe modifications: FAM 6-carboxyfuorescein, HEX 5-hexachlorofuorescein, THF Tetrahydrofuran, BHQ Black hole quencher, C3-spacer 3′ phosphate blocker