Skip to main content

Table 1 Primers used for PCR

From: A substitution in the pre-S1 promoter region is associated with the viral regulation of hepatitis B virus

Name Sequence (5′ to 3′) Annotation
F1 CGACTCAGGAAACTGCCTGTAAATAGAC HBV 950–970, pTac1 404–410 (sense)
F4 CCAAGCTAGAAGGAAAGAAGTCAGAAGG HBV 1958–1978, pTac1 498–504 (antisense)
F5 CAGTTTCCTGAGTCGTATTACGCGCTGG pTac1 391–410, HBV 950–957 (antisense)
F6 TTCCTTCTAGCTTGGCGTAATCATGGTC pTac1 498–517, HBV 1971–1978 (sense)
L1 AGActcgagCTTGGACAAAGGCATTAAAC XhoI, HBV 2678–2697 (sense)
L2 AGGagatctGAGGCGCTGCGTGTAGTTTC BglII, HBV 2787–2806 (antisense)
S3 TGAGTCGTATTACGCGCTGG pTac1 391–410 (antisense)
m5 AAAGCTGGCATTCTATATAAAAGAG HBV 2763–2787, Sp1 G2765A (sense)
m9 GCGACATAAGTTCTATATAAAAGAG HBV 2763–2787, Sp1 whole nucleotide mutation (sense)
  1. Nucleotides that were substituted with wild type are indicated in bold. Abbreviations: PCR polymerase chain reaction, HBV hepatitis B virus