Skip to main content

Advertisement

Table 1 The primers were used to construct the various truncated, internal deletion mutants by PCR

From: Identification of nuclear localization signal and nuclear export signal of VP1 from the chicken anemia virus and effects on VP2 shuttling in cells

Primer name Type Length Sequence (5′-3′)
VP1 EcoR1 Forward 25-mer AGAATTCATGGCAAGACGAGCTCGC
VP1 Xho1 R Reverse 20-mer TCCTCGAGGGGCTGCGTCTC
VP1 ND9 EcoR1 Forward 24-mer AGAATTCATGGGCCGATTTTACGC
VP1 DN19 EcoR1 Forward 26-mer AGAATTCATGCACAACCTCAAGCGAC
VP1 ND30 EcoR1 Forward 25-mer AGAATTCAAATTTCGCCATCGCCGC
VP1 ND60 EcoR1 Forward 25-mer AGAATTCCTGCCGAACCCGCAGAGC
VP1 ND129 EcoR1 Forward 25-mer AGAATTCGGCGAACTGATTGCGGAT
VP1 CD10 Xho1 Reverse 21-mer TCCTCGAGGCCTCTCGGTCTG
VP1 CD103 Xho1 Reverse 24-mer TCCTCGAGGGCGACTCTCGGCCCC TAAGATGG
VP1 CD126 Xho1 Reverse 22-mer TCTCGAGTCCGATTTTGCTCAC
VP1 internal NES deletion 1162 Forward 24-mer GCGGCCGCGGCACAAATAAGTCGC
VP1 internal NES deletion 1119 Reverse 27-mer GCGGCCGCATGATGCGGGTGCACT