Skip to main content

Table 1 The primers were used to construct the various truncated, internal deletion mutants by PCR

From: Identification of nuclear localization signal and nuclear export signal of VP1 from the chicken anemia virus and effects on VP2 shuttling in cells

Primer name Type Length Sequence (5′-3′)
VP1 internal NES deletion 1162 Forward 24-mer GCGGCCGCGGCACAAATAAGTCGC
VP1 internal NES deletion 1119 Reverse 27-mer GCGGCCGCATGATGCGGGTGCACT