Skip to main content

Advertisement

Table 2 Primers used for RT-PCR amplification and sequencing of VP7 (genome segment 9) of ERVA

From: Development and evaluation of a one-step multiplex real-time TaqMan® RT-qPCR assay for the detection and genotyping of equine G3 and G14 rotaviruses in fecal samples

Primer name Target Nucleotide Position Sequence (5′ to 3′) Application
RVAVP7-Gra-5 VP7 1-20a GGCTTTAAAAGCGAGAATTT RT-PCR and sequencing
RVAVP7-Gra-3 VP7 1062–1,044a GGTCACATCATACAACTCT RT-PCR and sequencing
RVAVP7–389-R VP7 389-370a CCAGTAGGCCATCCTTTAGT Sequencing
RVAVP7-635-F VP7 635-659a GTCCACTTAATACACAAACTCTAGG Sequencing
RVAVP7-241-R VP7 245-220a GCAGTRTCCATTGAACCAGTAATTG Sequencing
RVAVP7-852-F VP7 856-879a GAYATAACGGCTGATCCAACTACG Sequencing
RVAVP7-881-F VP7 885-906a CTCCACAGATTGGACGAATGA Sequencing
  1. anucleotide position based on GenBank Accession number KM454508.1