Skip to main content

Advertisement

Table 1 The ISG primers and probes used for real-time PCR

From: Anti-H7N9 avian influenza A virus activity of interferon in pseudostratified human airway epithelium cell cultures

Gene Sequence of primers and probes
GADPH F: GAAGGTGAAGGTCGGAGTC R: GAAGATGGTGATGGGATTTC P: FAM-AAGGTCGGAGTCAACGGATTTGGTC-TAMRA
ISG15 F: GGACAAATGCGACGAACCTC R: GCTCACTTGCTGCTTCAGG P: FAM-CCCGCCAGCATCTTCACCGT-TAMRA
MX1 F: TGCAGGACAAGGACACCTAC R: TCACCACGGCTAACGGATAA P: FAM-ATAAAGCCCAGAATGCCATCGCC-TAMRA
OAS1 F: AGCATTTTCCGTGAAGTTTG R: GGGTTAGGTTTATAGCCGCC P: FAM-AGAGGCCGATCTGACGCTGAC-TAMRA
IFITM3 F: GAGAACCATCCCAGTAACCC R: GACAGGAGAGAAGAAGGTTTGG P: FAM-TTCGCTGGACACCATGAATCACACT-TAMRA