Skip to main content

Advertisement

Table 1 Oligonucleotides used for cloning, sequencing and mutagenesis of VHSV DK-3592B cDNA fragments

From: The glycoprotein, non-virion protein, and polymerase of viral hemorrhagic septicemia virus are not determinants of host-specific virulence in rainbow trout

Primers Sequences Nucleotide no.a
VHSV-DK genome primers
 VHSV 1F GTATCATAAAAGATGATGAGT 1–21
 VHSV 1R CAGCTTGAACTTCTTCATGGC 2007–1987
 VHSV 2F AAGAAGACCGACAACATACTCT 1837–1858
 VHSV 2R GACGAAACTTTGAGAGGAGAAA 3971–3950
 VHSV 3F ATCTCATCACCAACATGGCTCAAA 3870–3893
 VHSV 3R TTGTTCGCCTCTCCCCTAATTGT 5926–5888
 VHSV 4F CCGCTATTGACTTGCTCAAATTG 5789–5812
 VHSV 4R CTGATCCATGGTGGCTATGTGAT 8020–7998
 VHSV 5F AGATGATTGTCTCCACCATGAA 7824–7845
 VHSV 5R GAGATCCGCTCTCGTTCATCAA 10,005–9984
 VHSV 6F GACAAGAAAGCTGGGAAGAGA 9765–9785
 VHSV 6R GTATAGAAAATAATACATACCA 11,159–11,138
 VHSV 1MF GGACAAGATGATCAAGTACATC 595–616
 VHSV 2MF CCATTCTCTGCGAAGATCAACA 2435–2456
 VHSV 3MF GATAAAGAAACATGGCGACCCA 4547–4568
 VSHV 4MF GGATCATCAGGAAGAGACACCA 6392–6413
 VHSV 5MF AGGCACACCACTTCACCATCCA 8412–8433
 VHSV-DK 5.3R CCTTGGATTCTTGTTGAGTCA 5280–5260
Mutagenesis primers
 VHSV-DK PmlF TTGTGTATACAACACGTGAGACCCACAATG  
 VHSV-DK PmlR CATTCCATTGTGGGTCTCACGTGTTGTATACACAA  
 VHSV SacIIF GTCTGAACACACCGCGGCGAATGACCACAATTCC  
 VHSV SacIIR GGAATTGTGGTCATTCGCCGCGGTGTGTTCAGA  
 VHSV NheF CCTCAGACAAGCTAGCACAAAAAAC  
 VHSV NheR GTTTTTTGTGCTAGCTTGTCTGAGG  
  1. aThe positions where the primers bind (nucleotide numbers) are according to the published sequence of VHSV DK-3592B genome in the GenBank under the accession number KC778774 (Yusuff and Vakharia, 2013)