Skip to main content

Table 1 Primers and probes used for PCV screening and sequencing

From: Detection of PCV3 in German wild boars

Primer, probe Sequence Accession number Position (nt - nt) Length of the amplicon (bp) Reference
PCV3_real_FW AGTGCTCCCCATTGAACG KT869077 1427–1444 135 Palinski et al., 2016 [6]
PCV3_seq2_FW GTCGTCTTGGAGCCAAGTG 1609–1627 825 Palinski et al., 2016 [6]
PCV1 fw (F41) ATACGGTAGTATTGGAAAGGTAGGG   441–465 688 Mankertz et al., 2000 [42]
PCV2 fw (F66) GGTTTGTAGCCTCAGCCAAAGC KT868491.1 567–546 416