Skip to main content

Advertisement

Table 1 Oligonucleotides used for real-time RT-PCR

From: DMO-CAP inhibits influenza virus replication by activating heme oxygenase-1-mediated IFN response

OLIGONUCLEOTIDE SEQUENCE (5′–3′)
5′ M2 (INFLUENZA) GACCRATCCTGTCACCTCTGAC
3′ M2 (INFLUENZA) GGGCATTYTGGACAAAKCGTCTACG
5’ IFN-β (M) AGCTCCAAGAAAGGACGAACAT
3’ IFN-β (M) GCCCTGTAGGTGAGGTTGATCT
5’ IFN-α (M) CCTGTGTGATGCAACAGGTC
3’ IFN-α (M) TCACTCCTCCTTGCTCAATC
5’ GAPDH (M) CTCTGGAAAGCTGTGGCGTGATG
3’ GAPDH (M) ATGCCAGTGAGCTTCCCGTTCAG
5’ GAPDH (D) AGTCAAGGCTGAGAACGGGAAACT
3’ GAPDH (D) TCCACAACATACTCAGCACCAGCA