Skip to main content

Advertisement

Table 1 Primer information for PCR

From: Characterization of small genomic regions of the hepatitis B virus should be performed with more caution

Primers for PCR
Primer name Primer sequence(5′-3′) Position in HBV genome
HBV-L-F1 GTTCATGTCCWACTGTTCAAGCCTCCAAG 1848–1876
HBV-L-R1 GGTGMRCAGACCAATTTATGCCTACAGCC 1779–1807
HBV-L-F2 CTCCAAGCTGTGCCTTGGGTGG 1870–1891
HBV-L-R2 CAGACCAATTTATGCCTACAGCCTCC 1776–1801
HBV-S-F1 GTCGCATGGARACCACCGTGAA 1603–1624
HBV-S-R1 CCGGAAGTGTTGATAAGATAGGGGCA 2308–2333
HBV-S-F2 GGTCTTRCATAAGAGGACTCTTGGACT 1646–1672
HBV-S-R2 GTGTTGATAAGATAGGGGCATTTGGTGGTCT 2297–2327