Skip to main content

Advertisement

Table 1 Real-time PCR primers sequences

From: Herpes simplex virus type 2 infection triggers AP-1 transcription activity through TLR4 signaling in genital epithelial cells

TLR1 Sense: CAGTGTCTGGTACACGCATGGT;
Antisense: TTTCAAAAACCGTGTCTGTTAAGAGA;
TLR2 Sense: GCCTCTCCAAGGAAGAATCC;
Antisense: TCCTGTTGTTGGACAGGTCA;
TLR3 Sense: TGGTTGGGCCACCTAGAAGTA;
Antisense: TCTCCATTCCTGGCCTGTG;
TLR4 Sense: AAGCCGAAAGGTGATTGTTG;
Antisense: CTGAGCAGGGTCTTCTCCAC;
TLR5 Sense: TGCCTTGAAGCCTTCAGTTATG;
Antisense: CCAACCACCACCATGATGAG;
TLR6 Sense: GAAGAAGAACAACCCTTTAGGATAGC;
Antisense: AGGCAAACAAAATGGAAGCTT;
TLR7 Sense: TTTACCTGGATGGAAACCAGCTA;
Antisense: TCAAGGCTGAGAAGCTGTAAGCTA;
TLR8 Sense: TTATGTGTTCCAGGAACTCAGAGAA;
Antisense: TAATACCCAAGTTGATAGTCGATAAGTTTG;
TLR9 Sense: GGACCTCTGGTACTGCTTCCA;
Antisense: AAGCTCGTTGTACACCCAGTCT;
MD2 Sense: CCGATGCAAGTATTTCATACACCTACT;
Antisense: CTCCTTGGAATGTAGAAAATGTGC;
GAPDH Sense: TGCACCACCAACTGCTTAGC;
Antisense: GGCATGGACTGTGGTCATGAG;