Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 The qPCR primers used in this study

From: RIG-I is responsible for activation of type I interferon pathway in Seneca Valley virus-infected porcine cells to suppress viral replication

Gene Primers(5′ → 3′)
SVV Forward: AGAATTTGGAAGCCATGCTCT
Reverse: GAGCCAACATAGARACAGATTGC
GAPDH Forward: ACATGGCCTCCAAGGAGTAAGA
Reverse: GATCGAGTTGGGGCTGTGACT
IFN-β Forward: GCTAACAAGTGCATCCTCCAAA
Reverse: AGCACATCATAGCTCATGGAAAGA
MXA Forward: GAGGTGGACCCCGAAGGA
Reverse: CACCAGATCCGGCTTCGT
GBP1 Forward: AGCACCTTCGTCTACAACAGC
Reverse: TCAGCCGAGTCCTCAATCC