Skip to main content

Advertisement

Table 1 The designed sgRNA sequences targeting porcine RIG-I gene

From: RIG-I is responsible for activation of type I interferon pathway in Seneca Valley virus-infected porcine cells to suppress viral replication

sgRNA Forward Reverse
sgRNA1 CACCGACGCTTTCGGGGACTATGTC AAACGACATAGTCCCCGAAAGCGTC
sgRNA2 CACCGCGGCGGAATCTGCACGCTTT AAACAAAGCGTGCAGATTCCGCCGC
sgRNA3 CACCGCGGAATCTGCACGCTTTCG AAACCGAAAGCGTGCAGATTCCGC