Skip to main content

Advertisement

Table 4 Primers and probes used in the present study

From: Comparative evaluation of a laboratory-developed real-time PCR assay and RealStar® Adenovirus PCR Kit for quantitative detection of human adenovirus

Target Primer/probe sequence (5′–3′) Tm (°C) Amplicon size (bp) PCR methodology
HAdV (hexon) Forward CAGTGGKCDTACATGCACATC 55.8 75 qPCR
Reverse GCGGGCRAAYTGCACSAG 60.3
Probe FAM- CTCAGGTACTCCGARGC-MGB-NFQ 53.1
Internal control Forward GTTCACCGATAGACCGCTG 55.5 113 qPCR
Reverse AAGAGCCCGGAATGTCAAGA 56.3
Probe Cy5-ACTACCTGAGCACCCAGTCCGCCCT-BBQ 67.3
HAdV (hexon) Forward GCCACCTTYTTCCCCATGGC 60.5 1004 Conventional PCR (1st round)
Reverse GTAGCGTTRCCGGCNGAGAA 59.8
  Forward TTCCCCATGGCNCACAACAC 59.6 956 Conventional PCR (nested); partial hexon gene sequencing
Reverse GCCTCRATGACGCCGCGGTG 65.2
  1. bp base pairs, Tm melting temperature