Skip to main content

Table 1 Sequences of the JCV-LAMP primers

From: A loop-mediated isothermal amplification assay for the detection and quantification of JC polyomavirus in cerebrospinal fluid: a diagnostic and clinical management tool and technique for progressive multifocal leukoencephalopathy

Primer Genome positiona Sequence (5′-3′)
F3 2985–3006 CTTAGTGATTTTCTCAGGTAGG
B3 3174–3191 TGGCATAAGCAACCTTGA
FIP (F1c + F2) 3073–3095, 3022–3043 TCCACCTGGAATTGTAACCATGA-CTATTTGCCTTACAAATCTGGC
BIP (B1c + B2) 3099–3121, 3149–3171 ACCTGTGTTCTTTTGTTTTGGTG-GCCTAAGAGATTACTTAGATGGA
LF 3045–3064 TCAGTGCCTAGAACTTTACA
  1. aGenome position in the large T antigen gene of JCV MY strain (accession number: AB038250)