Skip to main content

Advertisement

Table 2 Primers used for RT-PCR (or PCR) detection of target grapevine viruses

From: Survey for major viruses in commercial Vitis vinifera wine grapes in Ontario

Groups Viruses Primers Sequences (5′-3′) Product (bp) Target gene
A GRBV GRBaV685F GAGGGTTGTTTGAAGATAAAG 719 CP
GRBaV1403R CCATAATAAACAGCGTGGTC
GLRaV-3 LR3-CP107F TCTTAAARTAYGTTAAGGACGG 301 CP
LR3-CP407R GGCTCGTTAATAACTTTCGG
GLRaV-1 LR1-502F TTGAGRGCTCTBATAAAYGAAC 379 HSP70h
LR1-880R CGTTMARTTCGYCKACSGACA
GLRaV-2 LR2-14568F RCDATGGAGYTRATGTCYGA 525 CP
LR2-15092R AGCGTACATRCTYGCRAACA
B GVA GVA6538F TCTTCGGGTACATCGCCTTG 325 CP
GVA6862R TCRAACATAACCTGTGGYTC
GRSPaV RSP35 AGRYTTAGRGTRGCTAARGC 476 Rep
RSP36 CACATRTCATCVCCYGCAAA
GVB GVB6448F ATGGAAAATATATCCCKGATGG 603 CP
GVB7050R GTTAACCACCTATATYTCRACAG
C ToRSV ToRSV-1 CAGGAAGGTACAGACGCC 340 CP
ToRSV-2 ACGTCCACGTAACTTCTGG
GLRaV-4 LR4-13269F GGACAATTTAGGTAATGTWGTRGCTAC 490 P23 (ORF6)
LR4-13758R TATCCTCAGWGAGGAARCGG
GFkV GFkV5209F GTCCTCGGCCCAGTGAAAAAG 348 Rep
GFkV-5556R CAGGTTGTAGTCGGTGTTGTC
D GFLV GFLV3135F TTGAGATTGGWTCYCGTTTC 558 CP
GFLV3692R CTGTCGCCACTAAAAGCATG
GAMaV GAMaV6083F CTCGCGCTCCTCGCATTGTT 467 CP
GAMaV6549R CGTGACGAGGTTGGTCCCA
GSyV-1 GSyV5725F ATGATGCAACCGACCCTTCC 671 CP
GSYV6395R TGGAGGCTTTATTCAGAGAG
ArMV ArMV2291F CRGGTATTACGTGGGTTATGAG 292 CP
ArMV2582R GCTGCCTCAAACTCAGCATA
E GPGV GPGV6586F GAYATGTCGATTCGTCAGGAG 436 CP
GPGV7021R CGACTTCTGGTGCCTTATCAC
GLRaV-7 LR7-12163F CTAGTGAATTACACCGAGAAGTC 550 CP
LR7-12712R GTGACTTGGCACGCATGTATC
GRVFV GRVFV5646F GTYGAARTCTCTCTCTTCTCCCA 389 CP
GRVFV6034R ATTATGAGAGCAACCCACTGGAAG
  Internal reference gene UBI-F CCGCACTCTTGCTGATTACA 146 Ubiquitin-ribosomal protein L40–2
UBI-R GTGCATAACATTTGCGGCAG
  1. The full names of viruses that are included in this survey are provided in the list of abbreviations. CP capsid protein, HSP70h heat shock protein 70 homologue, Rep replicase protein