Skip to main content

Table 1 Nucleotide sequences of primers used for screening and sequencing in this study

From: Detection and genetic characterization of feline bocavirus in Northeast China

Primer name Nucleotide sequence (5′-3′) Product (bp) Application
FBoV1F TCTACAAGTGGGACATTGGA 133 Screening for FBoV-1 [11]
FBoV2F TCGTTCGTCTTGGAACATAGC 331 Screening for FBoV-2 [17]
FBD1L1 TGACTCGTCTGTGGCGGGCT 546 Screening for FBoV-3 [27]
FBOV1-NS1F TTTGGGGCTGAAGTCTGCTATGC 705 Sequencing for partial NS1 gene of FBoV-1
FBOV2-NS1F TTCGCGGATCCAGCATACACCTAC 963 Sequencing for partial NS1 gene of FBoV-2
FBoV1-55Fa CCGGCGCGATGACGTGTCAG 523 Sequencing for the complete genome of FBoV-1
FBoV2-66Fb GATGACGTGTCAGTGTGGGTGTTG 1278 Sequencing for the complete genome of FBoV-2
  1. aThe primer positions refer to the full-length genome of FBoV genotype 1 strain FBD2 (GenBank accession no. KM017745); bThe primer positions refer to the full-length genome of FBoV genotype 2 strain POR1 (GenBank accession no. KF792837)