Skip to main content

Advertisement

Table 1 Nucleotide sequences of primers used for screening and sequencing in this study

From: Detection and genetic characterization of feline bocavirus in Northeast China

Primer name Nucleotide sequence (5′-3′) Product (bp) Application
FBoV1F TCTACAAGTGGGACATTGGA 133 Screening for FBoV-1 [11]
FBoV1R GAGCTTGATTGCATTCACGA
FBoV2F TCGTTCGTCTTGGAACATAGC 331 Screening for FBoV-2 [17]
FBoV2R CAGAGCGTGGATCTGTCTGA
FBD1L1 TGACTCGTCTGTGGCGGGCT 546 Screening for FBoV-3 [27]
FBD1R1 TCGTTCGTGAGACGCTGCCA
FBOV1-NS1F TTTGGGGCTGAAGTCTGCTATGC 705 Sequencing for partial NS1 gene of FBoV-1
FBOV1-NS1R ATGCGGCTGAGATGTACCTTGACC
FBOV2-NS1F TTCGCGGATCCAGCATACACCTAC 963 Sequencing for partial NS1 gene of FBoV-2
FBOV2-NS1R CTCACAACGGCGCAAGCAGTCTA
FBoV1-55Fa CCGGCGCGATGACGTGTCAG 523 Sequencing for the complete genome of FBoV-1
FBoV1-577R GCGCCGCATAGCAGACTTCAG
FBoV1-550F TTTGGGGCTGAAGTCTGCTATGCG 1695
FBoV1-2245R CGATGTCGCCTCGATCGTGYAGTTC
FBoV1-2177F ATGAGACCGGAACGTGTATGAGCT 1407
FBoV1-3583R GGCGCCCCCTCTTGTCCAT
FBoV1-3553F AGACGGCTGGGGATGGACAAGA 1411
FBoV1-4963R GGYAGTGTGCCATCAGCCGAATC
FBoV1-4734F ATGGCTAGATGGGGTTCAGTG 635
FBoV1-5368R GTAGCAGTGTGGAGGGTGTTGTAT
FBoV2-66Fb GATGACGTGTCAGTGTGGGTGTTG 1278 Sequencing for the complete genome of FBoV-2
FBoV2-1343R ACGTTAGCCACAAATTATCCTCACA  
FBoV2-1306F CTGCTTGCGCCGTTGTGAGGATAAT 1102
FBoV2-2407R GTCTGGAGCACTGCCGCCGTCTG  
FBoV2-2384F ACAGACGGCGGCAGTGCTCCAGAC 1315
FBoV2-3698R CCATGCCCGCCACCCCCAGAG  
FBoV2-3653F GTGGGGGTGGCAGCGGTGTTGG 1014
FBoV2-4666R CGCCTCCCCTGTCTGGTATGTTGG  
FBoV2-4219F CTAAACGCAGATAATGTGGAAAAA 1176
FBoV2-5394R CAGTGTGGGTGATGTTGAGAAG  
  1. aThe primer positions refer to the full-length genome of FBoV genotype 1 strain FBD2 (GenBank accession no. KM017745); bThe primer positions refer to the full-length genome of FBoV genotype 2 strain POR1 (GenBank accession no. KF792837)