Skip to main content

Advertisement

Table 3 Primer information for qRT-PCR amplification

From: Generation and characterization of UL41 null pseudorabies virus variant in vitro and in vivo

Gene Primer sequence (5′ to 3′)
28S rRNA F: GGGCCGAAACGATCTCAACC
R: GCCGGGCTTCTTACCCATT
GAPDH F: ATCCTGGGCTACACTGAGGA
R: TGTCGTACCAGGAAATGAGCT
β-actin F: CTCTCTTCCAACCTTCCTTCC
R: CAGACTCGTCATACTCCTGCTT
UL41 F: TGAAGAACGAGACGCGGG
R: TGTGCTTCCAAAACAGGCCC
IE180 F: CATCGTGCTGGACACCATCGAG
R: ACGTAGACGTGGTAGTCCCCCA