Skip to main content

Table 2 Primers and probes used for detection of equid herpesvirus 2 (EHV-2) and EHV-5 among horses in Poland

From: Prevalence and sequence analysis of equid herpesviruses from the respiratory tract of Polish horses

Assay Virus Region Primers / probes (5′ to 3′) Size (bp) Reference
Real-time PCR EHV-2 gB Forward: GTGGCCAGCGGGGTGTTC 78 [42]
   Reverse: CCCCCAAAGGGATTYTTGAA   
   Probe: FAM-CCCTCTTTGGGAGCATAGTCTCGGGG-TAMRA   
EHV-5   Forward: AACCCGCCGTGCATCA 66  
   Reverse: AGGCGCCACACACCCTAA   
   Probe: FAM-ACAACACCACCAACCCCTTTCTGCTG-TAMRA   
Conventional PCR EHV-2   Forward: GATGGTCTCACCTCTAGCAT 1111 [12]
   Reverse: CTGGTGTAACACAGGTCTTC   
EHV-5   Forward: CCAACACAGAAGACAAGGAG 1339  
   Reverse: CACGGTGATACAGTCAGAGA   
  1. Fluorescent probes were dually labelled with carboxyfluorescein (FAM) and tetramethylrhodamine (TAMRA)