Skip to main content

Advertisement

Table 1 Primer sets used in the paper

From: Development of a GFP expression vector for Cucurbit chlorotic yellows virus

Primer name Sequence (5′-3′)
CCYVcgscF1F CTACTATTGGACGCGTTATTG
CCYVcgscF1GFPR CTCGCCCTTGCTCACCATATTTAATGTAGATCGAGT
CCYVcgscGFPF ACTCGATCTACATTAAATATGGTGAGCAAGGGCGAG
CCYVcgscGFPR ATACCAAGTTTTAATTAATCAAAGATCTACCATGTACAGC
CCYVcgscSPCSVCPpF AGATCTTTGATTAATTAAAACTTGGTATCGCGGTTG
CCYVcgscSPCSVpCPR ATTGTCAGTCTTCTCCATACTCGTCTCACTGCTTAG
CCYVcgscF2F CTAAGCAGTGAGACGAGTATGGAGAAGACTGACAAT
CCYVcgscF2R CGAAATCCCTCATACACTGTTC
CCYVCcgccF2F CGCTTAATTAATCAGTGATTATCTTCAAATTC
CCYVsgccF1R ACCAACCGCGATACCAAGTTTCAGTTAAAAAATTTTGGTA
CCYVsgccSPCSVCPpF TACCAAAATTTTTTAACTGAAACTTGGTATCGCGGTTGGT
CCYVsgccSPCSVCPpR CCTCGCCCTTGCTCACCATACTCGTCTCACTGCTTAGTT
CCYVsgccGFPF AACTAAGCAGTGAGACGAGTATGGTGAGCAAGGGCGAGG