Skip to main content

Advertisement

Table 2 Oligonucleotides used for real-time RT-PCR

From: Cirsimaritin inhibits influenza A virus replication by downregulating the NF-κB signal transduction pathway

OLIGONUCLEOTIDE SEQUENCE (5’–3’)
5’ M2 (INFLUENZA) GACCRATCCTGTCACCTCTGAC
3’ M2 (INFLUENZA) GGGCATTYTGGACAAAKCGTCTACG
5’ IL-1β CTCGCCAGTGAAATGATGGCT
3’ IL-1β GTCGGAGATTCGTAGCTGGAT
5’ TNF-α ACTTTGGAGTGATCGGCC
3’ TNF-α GCTTGAGGGTTTGCTACAAC
5’ IL-8 GGTGCAGTTTTGCCAAGGAG
3’ IL-8 TTCCTTGGGGTCCAGACAGA
5’ IL-10 AGGATCAGCTGGACAACTT
3’ IL-10 GATGTCTGGGTCTTGGTTCTC
5’ GAPDH (H) GGTGGTCTCCTCTGACTTCAACA
3’ GAPDH (H) GTTGCTGTAGCCAAATTCGTTGT
5’ GAPDH (D) AGTCAAGGCTGAGAACGGGAAACT
3’ GAPDH (D) TCCACAACATACTCAGCACCAGCA