Skip to main content

Advertisement

Table 1 Primer sequences used in the quantitative RT-PCR analysis

From: The truncated mutant HBsAg expression increases the tumorigenesis of hepatitis B virus by regulating TGF-β/Smad signaling pathway

Gene Forward Primers Reverse Primers
AP-1 ACGCAAACCTCAGCAACTTCA GATCCGCTCCTGGGACTCCAT
c-Myc GTTTCATCTGCGACCCG GCTGCCGCTGTCTTTGC
c-Fos TCCGAAGGGAAAGGAATAA GCTGCCAGGATGAACTCTA
CyclinD1 ACTCGTTACATACCCTTTACCTTTT TAACTCTGATAGACTTTTGCCATTC
NF-kBp65 TGCCGAGTGAACCGAAAC TGGAGACACGCACAGGAG
TGFBI CTTCGAGAAAGATCCCTAGTGAGA CGTTGATAGTGAGCATGTCCC
GAPDH AGGAGCGAGATCCCTCCAAAATCAAGT TGAGTCCTTCCACGATACCAAAGTTGT