Skip to main content

Advertisement

Table 1 Primers used in this study

From: Effects of the S42 residue of the H1N1 swine influenza virus NS1 protein on interferon responses and virus replication

Name Primer nucleotide sequence (5,-3,)a
NS1-F TATTCGTCTCAGGGAGCAAAAGCAGGGTG
NS1-R ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT
NS1–42-F GCCGAGATCAAAAGCCCCTAAAAGGAAGAG
NS1–42-R TCTTCCTTTTAGGGGCTTTTGATCTCGGCG
NS1–92-F CTACCTAGCTGAGATGACCCTCGAG
NS1–92-R CTCGAGGGTCATCTCAGCTAGGTAG
IFN-α-F CTGTCCTCCATGAGATGATCC
IFN-α-R CTCATGATTTCTGCTCTGACAACC
IFN-β-F GCTGGAATGAGACTATTGTTGAGA
IFN-β-R CAGTTTCGGAGGTAACCTGTAAG
TNF-α-F CGAGTCTGGGCAGGTCTA
TNF-α-R GTGGTGGTCTTGTTGCTTAA
β-actin-F TGGGTCAGAAGGACTCCTATG
β-actin-R CAGGCAGCTCATAGCTCTTCT
  1. aNucleotides that have been changed are shown in underlined