Skip to main content

Table 1 Primers used in the generation of HEV Rluc replicons and their mutants

From: Substitution of amino acid residue V1213 in the helicase domain of the genotype 3 hepatitis E virus reduces virus replication

Primer IDs

Primer Sequencea

Modificationsb

Replicon

 

TW4675F

5’ GCTATGAGTTCCGGGACCTCAA 3’

TW6196-Rluc

 

TW5168R

5’ GGTGGCATCGCCATGCAA 3’

 

TWJRhRlucU

5’ TTGCATGGCGATGCCACC ATGGCTTCCAAGGTGTACGAC 3′

 

TWhRlucL

5’ AGAATTCAGCGCTGCTAGCTATTACTGCTCGTTCTTCAGCACG 3’

 

SWhRluc1U

5’ TGCATCGCCCATGGGATCACCATGGCTTCCAAGGTGTACGAC 3’

pSHEV3-Rluc

 

SWhRluc915L

5’ CGGTTAACATATGCTAGCCTATTACTGCTCGTTCTTCAGCACG 3’

 

SWHEV4623U

5’ CGCCGAAGGAGTCTCTTAAGGGT 3’

 

SWHEV5208L

5’ GTCGTACACCTTGGAAGCCATGGTGATCCCATGGGCGATGCA 3’

Mutagenic

 

HEV3MvaU

5’ GTGAGGTCGGCATTTCGGATGCAATTGTCAATAACTTTTTCCTTG 3’

V1213A

 

HEV3MvaL

5’ CAAGGAAAAAGTTATTGACAATTGCATCCGAAATGCCGACCTCAC 3’

 

HEV3MqhU

5’ GATCAGAACCTCGGGACTCTACATGCCTTCCCGCCGTCCTGCCAG 3′

Q/H

 

HEV3MqhL

5’ CTGGCAGGACGGCGGGAAGGCATGTAGAGTCCCGAGGTTCTGATC 3’

 

HEV3MspU

5’ GTCTATGGGGGCCGGGCCTCATAGCCTCACTTATG 3’

S605P

 

HEV3MspL

5’ CATAAGTGAGGCTATGAGGCCCGGCCCCCATAGAC 3’

 

HEV3MivU

5’ GCTTGTGCCGGCTGCACTGTTAGTCCTGGGATTG 3′

I978V

 

HEV3MivL

5’ CAATCCCAGGACTAACAGTGCAGCCGGCACAAGC 3’

 

HEV3MvaHU

5’ GTGAGGTCGGCATTTCGGATGCTATTGTCAATAACTTTTTCCTTG 3’

V1213A (2nd)

 

TWMavU

5’ TGAGGTGGGTATCTCTGATGTTATTGTTAACAACTTCTTCC 3′

A1213V TW6196

 

TWMavL

5’ GGAAGAAGTTGTTAACAATAACATCAGAGATACCCACCTCA 3′

 

HEV2MavU

5’ GCGAGGTGGGCATCTCCGATGTGATCGTTAATAACTTTTTCCTTG 3’

A1213V Sar55

 

HEV2MavL

5’ CAAGGAAAAAGTTATTAACGATCACATCGGAGATGCCCACCTCGC 3’

  1. aSequences of primers
  2. bRluc inserted into HEV genomes or amino acid mutation introduced by the primer