Skip to main content

Table 1 Primers used in the generation of HEV Rluc replicons and their mutants

From: Substitution of amino acid residue V1213 in the helicase domain of the genotype 3 hepatitis E virus reduces virus replication

Primer IDs Primer Sequencea Modificationsb
Replicon
  TW4675F 5’ GCTATGAGTTCCGGGACCTCAA 3’ TW6196-Rluc
  TW5168R 5’ GGTGGCATCGCCATGCAA 3’
  TWJRhRlucU 5’ TTGCATGGCGATGCCACC ATGGCTTCCAAGGTGTACGAC 3′
  TWhRlucL 5’ AGAATTCAGCGCTGCTAGCTATTACTGCTCGTTCTTCAGCACG 3’
  SWhRluc1U 5’ TGCATCGCCCATGGGATCACCATGGCTTCCAAGGTGTACGAC 3’ pSHEV3-Rluc
  SWhRluc915L 5’ CGGTTAACATATGCTAGCCTATTACTGCTCGTTCTTCAGCACG 3’
  SWHEV4623U 5’ CGCCGAAGGAGTCTCTTAAGGGT 3’
  SWHEV5208L 5’ GTCGTACACCTTGGAAGCCATGGTGATCCCATGGGCGATGCA 3’
Mutagenic
  HEV3MvaU 5’ GTGAGGTCGGCATTTCGGATGCAATTGTCAATAACTTTTTCCTTG 3’ V1213A
  HEV3MvaL 5’ CAAGGAAAAAGTTATTGACAATTGCATCCGAAATGCCGACCTCAC 3’
  HEV3MqhU 5’ GATCAGAACCTCGGGACTCTACATGCCTTCCCGCCGTCCTGCCAG 3′ Q/H
  HEV3MqhL 5’ CTGGCAGGACGGCGGGAAGGCATGTAGAGTCCCGAGGTTCTGATC 3’
  HEV3MspU 5’ GTCTATGGGGGCCGGGCCTCATAGCCTCACTTATG 3’ S605P
  HEV3MspL 5’ CATAAGTGAGGCTATGAGGCCCGGCCCCCATAGAC 3’
  HEV3MivU 5’ GCTTGTGCCGGCTGCACTGTTAGTCCTGGGATTG 3′ I978V
  HEV3MivL 5’ CAATCCCAGGACTAACAGTGCAGCCGGCACAAGC 3’
  HEV3MvaHU 5’ GTGAGGTCGGCATTTCGGATGCTATTGTCAATAACTTTTTCCTTG 3’ V1213A (2nd)
  TWMavU 5’ TGAGGTGGGTATCTCTGATGTTATTGTTAACAACTTCTTCC 3′ A1213V TW6196
  TWMavL 5’ GGAAGAAGTTGTTAACAATAACATCAGAGATACCCACCTCA 3′
  HEV2MavU 5’ GCGAGGTGGGCATCTCCGATGTGATCGTTAATAACTTTTTCCTTG 3’ A1213V Sar55
  HEV2MavL 5’ CAAGGAAAAAGTTATTAACGATCACATCGGAGATGCCCACCTCGC 3’
  1. aSequences of primers
  2. bRluc inserted into HEV genomes or amino acid mutation introduced by the primer
\