Skip to main content

Table 1 Primers towards the S, M and L segments of PUUV

From: Quantification and kinetics of viral RNA transcripts produced in Orthohantavirus infected cells

Segment Primer name Sequence Binding
S-Primer PuKzSF2 GAARTGGACCCGGATGACGTTAAC 139–162
PuKzSR2 CKGGACACAGCATCTGCCATTC 233–254
M-Primer PuKzMF1 AACTTAGTCCAGTTTGTCTGTATCTG 48–73
PuKzMR1 CCAATAGTRTGTGGACATTCCATTTT 131–156
L-Primer PuKzLF1 CAAAGGGCACAAGCAAGAATTGTTAG 2659–2684
PuKzLR3 GTWATAAAAAAACCTCTATCAGC 2704–2726