Skip to main content

Table 1 Primers and probes

From: Molecular subtyping of European swine influenza viruses and scaling to high-throughput analysis

Target Gene Primer/Probe Sequence, labeling Locationa Reference Sequence (accession number)
H1av H1av_Fo gaaggrggatggacaggaatga 1063–1084 A/Sw/Cotes d’Armor/0388/2009 (KC881265)
H1av_Re caattahtgarttcactttgttgc 1178–1201
H1av_Pr (HEX)-tctggttacgcagcwgatcagaaaa-(BHQ1) 1126–1150
H1hu H1hu_Fo_1 gagggggrtggaccggaatgatagatgga[i]5tggttatcatca 1090–1109 A/Sw/Cotes d’Armor/0113/2006 (AM503902)
H1hu_Fo_2 ggatggtacggttatcatca 1064–1109
H1hu_Re_1 acctacagctgtgaattgagtgttcatyttntcg[i]5agagttcacct 1184–1204
H1hu_Re_2 tttcgatcacagaattcacct 1184–1233
H1hu_Pr (FAM)-cagggatctggctatgctgcagayc-(BHQ1) 1120–1144
H1huΔ146–147 H1hu_dif_Fw agttcagtatcatcattcgagagattcgaaat 367–398 A/Sw/France/22-130212/2013 (KJ128323)
H1hu_dif_Rv actgcatcatgctcccataagggga 468–492
H1hu_var_FAM (FAM)-cagcataggagca-(MGB) 454–466
H1pdm H1pdm_Fo gggcattcaccatccatctact 582–603 A/California/04/2009 (FJ966082)
H1pdm_Re cctcactttgggtcttattgctattt 689–714
H1pdm_Pr (FAM)-atacagcaagaagttcaagc-(MGB) 666–685
H3 H3_Swine_Fw cttgatggrgmaaaytgcaca 223–243 A/Sw//France/59–120031/2012 (KC345622)
H3_Swine_Rv ggcacatcatawgggtaaca 337–356
H3_Swine_CY5 (or HEX) (CY5 or HEX)-ctctattgggrgaccctcaytgtga-(BHQ1) 254–278
N1 N1.3_F agrccttgyttctgggttga 1255–1274 A/Sw/Germany/SIV04/2008 (FN429079) [20]
N1.3_R accgtctggccaagacca 1363–1380
AIV N1.3 FAM (FAM)-atytggacyagtgggagcagcat-(BHQ1) 1306–13,028
N1pdm N1pdm_Fo gggacagacaataacttctcaataaagc 1144–1171 A/California/04/2009 (FJ966082)
N1pdm_Re ttcagcatccagaactaacagggt 1220–1243
N1pdm_Pr (FAM)-aaatgagtggtcaggatat-(MGB) 1188–1206
N2 N2_1367F agtctggtggacytcaaayag 1305–1325 A/Sw/Bakum/8602/1999 (EF409258) [20]
N2_1468R ttgcgaaagcttatatagvcatga 1397–1420
AIV N2 1444 HEX (HEX)-ccatcaggccatgagcctgwwccata-(BHQ1) 1357–1382
M SIV-Forw agatgagtcytctaaccgaggtcg 24–47 A/Sw/France/22–130212/2013 (KM267912) [30]
SIV-Rev tgcaaaracayyttcmagtctctg 101–124
M64_FAM (FAM)-tcaggccccctcaaagccga-(BHQ1) 74–93
β-actin Sw_actine_Forw ctcgatcatgaagtgcgacgt   [31]
Sw_actine_Rev gtgatctccttctgcatcctgtc  
β-actine_sus_scrofa_HEX (HEX)-atcaggaaggacctctacgccaacacgg-(BHQ1)  
  1. aFrom the first nucleotide of the coding sequence, except for M (from the first nucleotide of the segment)