Skip to main content

Table 4 Sequence results of amplified PCR fragments

From: Monitoring of Poyang lake water for sewage contamination using human enteric viruses as an indicator

Site Blast Matched DNA E value Identity Sequence
3.2 KC911703.1 Norovirus Hu/GII/NEC-365/THA/ 5.00E-10 98% ATAATCATTACCCAAGTTTAAATGAAGAGGAGACGCATCTGGCTCCCAGTTTTGTGAAT
GAAGATGGC
1.2 EU151450.1 Swine vesicular disease virus strain SVDV Itl. 1–92 5.00E-33 96% CCATGGCTAGGACTGACTACTTTGATACGGCTAATCCTCACTCGCGTGAGCAGATACCCA
CACACCAGTGGGCAGTCTGTCGTAATGGGCAACTCTGCAGCGGAACCGACTACTTTGG
1.3; 2.4 GU236215.1 Human echovirus 11 isolate 39,351.82 5’ UTR 6.00E-42 100% AAGGTGAGGACCAGTACTCCTGAATGCGGCTAATCCTAACTGCGGAGCAGATACCCAC
ACACCAGTGGGCAGTCTGTCGTAATGGGCAACTCTGCAGCGGAACCGACTACTTTGG
1.1 KX458103.1 Norovirus GI.9 strain 1.00E-09 98% GGGGGTGGCGTCTAAGACATCTCCTACCCGATTATGTAAATGATGATGGCGTCTAAGGA
2.6 KF303071.1 Human adenovirus 41 isolate 10–4851 2.00E-31 98% TGGGAACCTGCCTTAAGTCGATATCTCGTGGCGCGGGCAAACTGCACCAGGCCCGGA
CTCAGATACTCCGAGGCGTCCTGCCCGGCGATGTGCATGTAAGACCACTGGGGCAG
2.5 GU236272.1 Human echovirus 25 isolate 06.048.1621 5’ UTR 1.00E-40 99% GAGGACGAACACAGACCAACCGCCCACTGGTGTGTGGGTATCTGCTCCGCAGTTAGGAT
TAGCCGCATTCAGGGGCCGGAGGATTACCAATTAGCTCAATAGACTCTTCACACCATGTAA
2.5; 4.6; 4.5; 4.4 LT628548.1 Human adenovirus 41 partial Hexon gene for Hexon gene pseudogene, strain Muonio/11V1867_3/2012/FIN 5.00E-32 97% TAGGCCTTGGTCTTAATTCGATATCTGGTGGCGCGGGCAAACTGCACCAGGCCCGGACT
CAGATACTCCGAGGCGTCCTGCCCGGCGATGTGCATGTAAGACCACTGGGGCAG
3.2; 5.3 JX412882.1 Human adenovirus 41 isolate CR6724 hexon gene 5.00E-37 100% TGCTGGCGAGTCGTATCGGTGGCGCGGGCAAACTGCACCAGGCCCGGACTCAGATA
CTCCGAGGCGTCCTGCCCGGCGATGTGCATGTAAGACCACTGGGGCACA
3.3; 4.4 AB112114.1 Human norovirus Saitama gene for RNA dependent RNA polymerase, 3.00E-15 100% AGGGGCCGTGATTGCGATCTCCTGTCCACAAGCTCAAGTCATGGAACCGCATCCAGCGA
3.3 JX412882.1 Human adenovirus 41 isolate CR6724 hexon gene 5.00E-37 100% TAGACGGCCGAGTCGTATCGGTGGCGCGGGCAAACTGCACCAGGCCCGGACTCAGATA
CTCCGAGGCGTCCTGCCCGGCGATGTGCATGTAAGACCACTGGGGCACA
4.6 KX907729.1 Norovirus Hu/USA/2011/GI.P7_GI.7/CS5567 5.00E-13 98% GGTAGGCGTCTGATCGCACTCTCCTACCCGATTATGTAAATGATGATGGCGTCTAAGGA
4.5 AB504701.1 Norovirus sewage/GI.7/Toyama/SW0703–10/2007/JP genes 1.00E-15 100% ACGACTGTGATTGCGATCTCCTGTCCACAAGCTCAAGTCATGGAAACGCATCCAGCGA
3.1 JX439815.1 Norovirus Hu/GII/Seoul1055/KOR/2010 3.00E-12 98% TGGTCCGACTCCGGCGCCGACAATCGGGCGCTCCGCAATCTGGCTCCCAGTTTTGTGA
ATGAAGATGGCGTCGACT
4.5 KJ489414.1 Human coxsackievirus B3 strain 2679 1.00E-40 96% GGTCATTCGACGACTGCGCACTGGTGTGTGGGTATCTGCTCCGCAGTTAGGATTAGCCG
CATTCAGGGGCCGGAGGATTACCAATTAGCTCAATAGACTCTTCACACCATGTAGA
5.1; 5.2 LC147086.1 Norovirus Hu/GI/Toyama/outbreakApr3741 /2010/JP 9.00E-10 100% GGCATGCGTCTGACGCATCTCCTACCCGATTATGTAAATGATGATGGCGTCTAAGAGA
5.1 KC911664.1 Norovirus Hu/GII/CC-685/THA/2006 RNA polymerase and capsid genes 2.00E-14 98% TTGCCCCAGACGGGCATCGGTAGGTGGGGCGATCGCATCTGGCTCCCAGTTTTGTGA
ATGAAGATGGCGTCGA
6.4 KX446506.1 Norovirus GII strain GII/Hu/NL/2010/GII 1.00E-21 97% CAACGGATCTGAGCCGTGGGAGGGCGATCGCATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGA
6.6; 7.1; 8.6 JX976770.1 Human coxsackievirus B3 isolate CVB3SD2012CHN 1.00E-39 99% ACCTTGCCGTACACAGTACACTGTATGCGGCTAATCCTAACTGCGGAGCAGATACC
CACACACCAGTGGGCAGTCTGTCGTAATGGGCAACTCTGCAGCGGAACCGACTACTTTGGAC
\