Skip to main content

Table 2 List of PCR primers used in this study with optimal amplification conditions

From: Monitoring of Poyang lake water for sewage contamination using human enteric viruses as an indicator

Virus Primer name Primer Sequence (5′ → 3′) Length (bp) Amplification condition Reference
TA Mg (mM) Primer (μM) BSA  
NoV GI QNIF4 CGCTGGATGCGNTTCCAT 8
6
58 2.0 0.4 Yes Loisy et al., 2005
NV1LCR CCTTAGACGCCATCATCATTTAC
NoV GII COG2F CARGARBCNATGTTYAGRTGGATGAG 9
7
58 2.0 0.8 Yes Kageyama et al., 2003
COG2R TCGACGCCATCTTCATTCACA
EoV EQ-1 ACATGGTGTGAAGAGTCTATTGAGCT 1
4
2
60 1.5 0.6 Yes Dierssen et al., 2008
EQ-2 CCAAAGTAGTCGGTTCCGC
AdV ADV-F GCCACGGTGGGGTTTCTAAACTT 1
3
2
54 1.5 0.6 Yes Gunson et al., 2009
ADV-R GCCCCAGTGGTCTTACATGCACATC
  1. aNoV GI, human norovirus genotype I; NoV GII, human norovirus genotype II; EoV, human enterovirus; AdV, human adenovirus
\