Skip to main content

Table 2 Oligonucleotides used for cloning of the supporting plasmids, construction of pFLC-LS1-1eGFP, and confirmation of virus recovery

From: Development of a novel Newcastle disease virus (NDV) neutralization test based on recombinant NDV expressing enhanced green fluorescent protein

Primers Sequences (5′ → 3′)a,b Restriction site Nucleotide Positionc
Supporting plasmid primers
pFLC-LS1-1eGFP construction
Confirmation primers
M + 4100 d AGTGATGTGCTCGGACCTTC N.A.e 4100–4119
  1. aRestriction sites sequences are underlined
  2. bKozak sequence is shown in bold
  3. cThe positions where primers bind are according to the published NDV sequence (GenBank Accession no. Y18898)
  4. dThis primer was taken from Wise et al. [26]
  5. eNot applicable