Skip to main content

Advertisement

Table 2 Oligonucleotides used for cloning of the supporting plasmids, construction of pFLC-LS1-1eGFP, and confirmation of virus recovery

From: Development of a novel Newcastle disease virus (NDV) neutralization test based on recombinant NDV expressing enhanced green fluorescent protein

Primers Sequences (5′ → 3′)a,b Restriction site Nucleotide Positionc
Supporting plasmid primers
Nfor GGAATTC GCCACCATGTCTTCCGTATTTGATG EcoRI 116–140
Nrev GCGGCCGCTCAATACCCCCAGTCGGTGT NotI 1572–1591
Pfor TGAATTC GCCACCATGGCCACCTTTACAGATGC EcoRI 1886–1906
Prev GCGGCCGCTTAGCCATTTAGAGCAAG NotI 3057–3074
Lfor TACTAGT GCCACCATGGCGAGCTCCGGTCCTGAA SpeI 8380–8401
Lrev GCGGCCGCTTAAGAGTCACAGTTACTGT NotI 14,976–14,995
pFLC-LS1-1eGFP construction
NDV116_F GCCAACATGTCTTCCGTATTTGATG PciI 116–140
NDV3211_R CGATCATTCAGTGGGGCTGAGG BbvCI 3190–3211
Confirmation primers
M + 4100 d AGTGATGTGCTCGGACCTTC N.A.e 4100–4119
NDV4394_R GAGACGCAGCTTATTTCTTAAAAGG N.A. 4370–4394
NDV14035_F TCCAGGGTCCAATCAAAGCT N.A. 14,035–14,054
NDV15003_R GATTTTCGTTAAGAGTCACAGTTACTG N.A. 14,977–15,003
  1. aRestriction sites sequences are underlined
  2. bKozak sequence is shown in bold
  3. cThe positions where primers bind are according to the published NDV sequence (GenBank Accession no. Y18898)
  4. dThis primer was taken from Wise et al. [26]
  5. eNot applicable