Skip to main content

Advertisement

Table 2 Gene functions and mRNA primers used in this study. Primers were designed using EBV genes mapped to the B95.8 genome

From: Interferon-γ-inducible protein 16 (IFI16) is required for the maintenance of Epstein-Barr virus latency

EBV Gene Temporal Class Function Forward primer (5′-3′) Reverse primer (5′-3′)
BZLF1 Immediate early transcriptional transactivator ACGACGCACACGGAAACC CTTGGCCCGGCATTTTCT
BALF2 Early ssDNA binding protein GTGAGCTACGCACCCGCCAT CTGACCGGTTGACTTCG
BZLF2 Late envelope glycoprotein gp42 CATCGCACTTGTTATTGTTC CAGACCTCTACATTTGGTTTG
BcRF1 Late vIL-10 GACAAAGGACGAGGTAGATAA CTCCAGGTAGAATTGGATCATT
EBNA1 Latent tethers EBV to sister chromatids in host cell CCGCAGATGACCCAGGAGAA TGGAAACCAGGGAGGCAAAT
IFI16 n/a Host protein CCCAAAGAAGATCATTGCCATAG GTTTCGGTCAGCATTCACATC
β-Tubulin n/a Host protein TCCAGATTGGCAATGCCTG GGCCATCGGGCTGGAT