Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Gene functions and mRNA primers used in this study. Primers were designed using EBV genes mapped to the B95.8 genome

From: Interferon-γ-inducible protein 16 (IFI16) is required for the maintenance of Epstein-Barr virus latency

EBV Gene Temporal Class Function Forward primer (5′-3′) Reverse primer (5′-3′)
BZLF1 Immediate early transcriptional transactivator ACGACGCACACGGAAACC CTTGGCCCGGCATTTTCT
EBNA1 Latent tethers EBV to sister chromatids in host cell CCGCAGATGACCCAGGAGAA TGGAAACCAGGGAGGCAAAT