Skip to main content

Advertisement

Table 1 Real-time PCR Primers and probes specifications

From: Association of IFITM3 rs12252 polymorphisms, BMI, diabetes, and hypercholesterolemia with mild flu in an Iranian population

Primers/Probes Sequence (5′ > 3′) Working Concentration
InfA Forward GAC CRA TCC TGT CAC CTC TGA C 40 μM
InfA Reverse GCA TTY TGG ACA AAK CGT CTA 40 μM
InfA Probea TGC AGT CCT CGC TCA CTG GGC ACG 10 μM
SW InfA Forward GCA CGG TCA GCA CTT ATY CTR AG 40 μM
SW InfA Reverse GTG RGC TGG GTT TTC ATT TGG TC 40 μM
SW InfA Probeb CYA CTG CAA GCC CA“T” ACA CAC AAG CAG GCA 10 μM
Flu B Primera M GAGACACAATTGCCTACCTGCTT 10 pm
Flu B Primerb M TTCTTTCCCACCGAACCAAC 10 pm
B Probe M AGAAGATGGAGAAGGCAAAGCAGAACTAGC 5 pm
Rnase P Forward AGATTTGGACCTGCGAGCG 40 μM
Rnase P Reverse GAGCGGCTGTCTCCACAAGT 40 μM
Rnase P Probea TTCTGACCTGAAGGCTCTGCGCG 10 μM
  1. aTaqMan probes are labeled at 5′- end with the reporter molecule 6- carboxyfluorescein (FAM) and with the quencher Blackhole Quencher 1 (BHQ1) at the 3′- end
  2. bTaqMan probes are labeled at 5′- end with the reporter molecule 6- carboxyfluorescein (FAM) and quenched internally at a modified “T” residue with BHQ1 with a modified 3′- end to prevent probe extension by Taq polymerase