Skip to main content

Advertisement

Table 1 Primers of the ToCV, CCYV and whitefly

From: Detection and epidemic dynamic of ToCV and CCYV with Bemisia tabaci and weed in Hainan of China

Name Primer Sequence
ToCV F AAACTGCCTGCATGAAAAGTCTC
R GGTTTGGATTTTGGTACTACATTCAGT
CCYV F CGCAATCAATAAGGCGGCGACC
R ACTACAACCTCCCGGTGCCAACT
Whitefly F TTGATTTTTTGGTCATCCAGAAGT
R CTGAATATCGRCGAGGCATTCC