Skip to main content

Table 1 List of PCR primers

From: The impact of p53 on the early stage replication of retrovirus

Name of primers 5′ to 3’ Target
RT-F ACTTATCTGTGTCTGTCCGATTG Late RT
RT-R GAACTCGTCAGTTCCACCAC Late RT
LTR-F CTGAGCGGCTTCGAGGATAAA 1-LTR and 2-LTR
LTR-R ACGCAGGCGCATAAAATCAG 1-LTR and 2-LTR
2-LTR-F TGTGGTCTCGCTGTTCCTTG 2-LTR
2-LTR-R AGTTGCATCCGACTTGTGGT 2-LTR
β-globin-F CCCTTGGACCCAGAGGTTCT β-globin
β-globin-R CGAGCACTTTCTTGCCATGA β-globin
\