Skip to main content

Table 1 Reverse-transcription quantitative polymerase chain reaction primers used for quantification of southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV)

From: Co-infection of two reoviruses increases both viruses accumulation in rice by up-regulating of viroplasm components and movement proteins bilaterally and RNA silencing suppressor unilaterally

Purpose Gene name Target gene (GenBank accession no.) Primer for RT-qPCR(5′-3′) Size of expected amplicon (bp)
RRSV RRSV P1 HM125559 AGGATCTCTTCTCAATGCAAGC 70
AACTTCCACCTGGCAACGTC
RRSV P2 HM125560 GGCGTTCGATCTCGTGTTTAA 69
GCGGGAAAATCATTGGCGTG
RRSV P3 AF020336 TCAAAGCTAGTGATGAGCGTCTGT 70
CTGGCATAAAAACGAAGAGTCTGA
RRSV P4A HM125562 GGCGTCAGTGTGTAGCAGCAT 66
ATTGGGTAGAGTTGTTGTTTTGGAT
RRSV P4B HM125562 CGCCATCCACAAAGCTATCA 63
AACACTCTCGTAGCCTGCCAAT
RRSV P5 HM125562 CGCCATCCACAAAGCTATCA 59
AACACTCTCGTAGCCTGCCAAT
RRSV S5 HM125543 GGCGGCATCGGGTTGT 59
CACCTCTATCAAACGCAGTAACCA
RRSV S6 HM125554 GCTTTCGCGGTGCTCAA 59
CTCCCAATTACGCACCGAAT
RRSV P7 HM125555 TGACGATTACGCCGAGACAAG 62
CGGACGACTGGCCAATG
RRSV P8 HM125546 GGCTGAGCGTGCGGTTA 66
TCAGCCTTGATATCGTTGTAGCA
RRSV P9 L79969 GGTGTGGCTCTACAACAAATGG 67
ACGCCTCTTTCTCTGCTCCTCTA
RRSV P10 HM125568 CCGAGCCGCCATCATAGTA 63
ACCTCAAAAACTCCAGACAGCATA
SRBSDV SRBSDV P1 JQ692572 TGTGATTTGAACTCAGAGACAGCTTTA 80
TGACGTTGATAAGTTGATTGTTGAGA
SRBSDV P2 HM585278 GCGAACGGCTTTCTGCTTT 71
GAATGTGCGAGTGATTTCATGAA
SRBSDVP3 HM585277 TCCCGGTGTTCGAGAAGTTC 64
CAGCATTTTCCATCCAACCAT
SRBSDV P4 HM585276 TCAACGCTCGACAACCAAAA 72
TTATCGTGATATCTGCTACGAATACCA
SRBSDV P5-1 HM585275 ATCAGATGATAACCTCAATCGTACCA 94
TGAGCCAGTGAAGGTAATCATCATTA
SRBSDV P5-2 CGCTTAACAATTGTCGTGATATGAA 75
GCGTGCTTCCGAAAAGTAAAGTT
SRBSDV P6 HM585274 AAGCAACAAACATCAACGTCAAA 69
AACTACGTCGGCCCATGAAC
SRBSDV P7-1 HM58527 CCTAATGAAAACCCATCTACCTGTAAC 70
CACGAATAAACATCAGCGACAAA
SRBSDV P7-2 CAAATATTTAGTAGAAGCAGAACGCAAGT 61
ACATCTTTTTCGTCTTTCTCATACTCTTAA
SRBSDV P8 HM585272 GATTGTCTCCTTTGGATGATGTTG 72
CCTGTCCTTCTTGAAATACACGTAAC
SRBSDV P9-1 HM585271 TGAAAGCGAATCCTCAACTAAAGA 68
TTGAATCAGTGGAGGTGGGTTT
SRBSDV P9-2 CGAGATGAGCGATTCTGGTTT 70
TTCGTGAATGATGTTGTTAACCTTTT
SRBSDV P10 EU784840 TCATCATTAGCGCGACTAGTTCA 64
CGTCACTCGGCGTCGATAA
Reference U6 S83742 CGATAAAATTGGAACGATACAGA 72
ATTTGGACCATTTCTCGATTTGT