Skip to main content

Table 1 The primers used for polymerase chain reaction (PCR)

From: A novel bladder cancer - specific oncolytic adenovirus by CD46 and its effect combined with cisplatin against cancer cells of CAR negative expression

PCR primers Primers sequence
PSCAE Forward: 5′ GCTGACCGGTAGAGGCCAGCAGCACCCCTG 3′
Reverse: 5′ CGGTGCTAGCAACTGCTTCCGTGTGTGGCTGACAG 3’
UPII Forward: 5’ ACT TTG AGC CTA CCC TTC C 3′
Reverse: 5′ CAG TGA GCC GAG ATT GTG 3’
E1A Forward: 5’ CAT GCC ACA GGT CCT CAT ATA GC 3′
Reverse: 5′ GAG ACA TAT TAT CTG CCA CGG AGG 3’
  1. PSCAE prostate stem cell antigen enhancer, UPII uroplakin II promoter, E1A the early adenoviral genes