Skip to main content
Download PDF

3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide inhibits expression of HPV oncogenes in human cervical cancer cell

Virology Journal volume 14, Article number: 145 (2017) Cite this article

Abstract

Background

Human papillomaviruses (HPVs) are the primary causative agents for cervical cancer, and HPV oncoproteins E6 and E7 are known to be the main reason for the onset and maintenance of the malignancies. Therefore, inhibition of viral E6 and E7 oncoproteins expression represents a viable strategy to cervical cancer therapies. This study is to evaluate the antiviral effect of a novel N-Phenylbenzamide derivative, 3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide (L17), against HPV16 in vitro and identify its associated mechanism of action in cervical cancer cells.

Methods

The cytotoxic effect of L17 was assessed by MTT assay. The mRNA and protein levels of E6 and E7 oncogenes were analyzed by quantitative real-time reverse transcription PCR (qRT-PCR) and Western blot, respectively. p53 and Rb protein levels were also detected by Western blot. The effect of L17 on cell cycle was analyzed by flow cytometry.

Results

The cytotoxic effect of L17 was greater in cervical carcinoma cells than in normal cells. L17 significantly reduced the expression of HPV16 E6 and E7 mRNA and protein, at least partly by enhancing degradation of HPV16 E6 and E7 mRNA. Moreover, reduced expression of E6 and E7 induced by L17 resulted in the up-regulation of p53 and Rb expression, which subsequently induced CaSki cells arrest at G0/G1 phase.

Conclusions

L17 has antiviral activity through suppressing E6 and E7 oncogene expression and could inhibit CaSki cell proliferating by inducing cells arrest at G0/G1 phase at nontoxic concentration, implying that L17 might be exploited as a candidate agent for HPV-associated cervical cancer prevention and treatment.

Background

Cervical cancer is one of the leading causes of cancer death in female [1, 2]. Approximately 99.7% of cervical cancers are caused by high-risk (HR) human papillomavirus (HPV), a small double-stranded DNA virus [3,4,5,6]. Although HPV vaccines have been shown to be effective, they only offer prophylactic protection against a minor fraction of HPV serotypes, and have no therapeutic effect for existing HPV infections [7]. In addition, there is no approved antiviral drug for the treatment of HPV infection [8, 9]. The current therapy relies on non-specific removal of infected tissue by often painful ablative procedures [8]. While this strategy may allow for elimination of signs and symptoms, recurrence rates are high due to subclinical virus infection of adjacent tissue [10]. What’s more, for patients with cervical lesions, this strategy may have negative effects on the future reproductive outcomes [11]. These highlight an urgent need for development of efficacious virus-specific inhibitors to overcome HPV-associated cervical cancer.

Two viral oncoproteins E6 and E7 are the main reasons for the development of cervical cancer through binding to two tumor suppressor proteins, p53 and Rb, and neutralizing their functions [12, 13]. E6 protein can facilitate tumor suppressor protein p53 degradation via the ubiquitin proteolytic pathway, which shortens the half-life of p53 and reduces its concentration, leading to the overrides at the G1/S and G2/M checkpoints [14, 15]. This is the major cause of chromosomal instability and thus leads to the mutation of the HPV-positive cells. Similarly, E7 oncoprotein induces the ubiquitin-mediated proteolysis, and disrupts its association with the E2F family of transcription factors via interacting with the tumor suppressor protein Rb, which subsequently activates genes associated with cell cycle progression [16, 17]. Therefore, inhibition of viral E6 and E7 oncoprotein expression represents a viable strategy that might restore growth control in tumor cells or sensitize cells to cancer therapies.

In our screening for drug candidates exhibiting inhibitory activity against HPV, we found that a novel N-Phenylbenzamide derivative, 3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide, named L17, was active in inhibiting the expression of HPV oncoproteins E6 and E7. This is the first report of the anti-HPV activity of the N-phenylbenzamide derivative, to the best of our knowledge. The main objective of the present study is to evaluate the antiviral effect of L17 against HPV16 in vitro and identify its associated mechanism of action in cervical cancer cells.

Methods

Drug

L17 (HPLC>98%) was synthesized in Chinese Academy of Medical Sciences and Peking Union Medical College and its chemical structure is shown in Fig. 1a. The compound was dissolved in Dimethyl sulfoxide (DMSO) at 100 mg/ml as a stock solution and further diluted in culture medium prior to use.

Fig. 1
figure 1

L17 dose-dependently inhibited the expression of E6 and E7 proteins in CaSki cells. a The chemical structure of L17. b MTT assays for CaSki, HeLa, C-33A, HaCaT and MRC-5 cells. c L17 reduced the expression of HPV16 E6 and E7 proteins in CaSki cells by western blot assay. d The effect of L17 on the degradation of HPV16 E6 and E7 proteins by western blot assay. Data represent as mean ± SD

Full size image

Cell culture

The CaSki (human cervical cancer cells, HPV 16 positive), HeLa (human cervical cancer cells, HPV 18 positive), C-33A (human cervical cancer cells, HPV negative), HaCaT (Human keratinocyte cells, HPV negative) and the MRC-5 (human lung fibroblast cells, HPV negative) were obtained from American Type Culture Collection (ATCC). CaSki cells were cultured in RPMI 1640 media (Invitrogen, Carlsbad, CA, USA), HaCaT cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen); C-33A, HeLa and MRC-5 cells were cultured in minimum essential medium (MEM, Invitrogen), respectively, containing 10% Fetal Bovine Serum (Gibco, Grand Island, NY, USA), 100 U/ml penicillin G and 100 mg/ml streptomycin [18]. All cells were incubated in humidified atmosphere containing 5% CO2 at 37 °C.

Cytotoxicity assay

The cytotoxic effects of L17 on CaSki, HeLa, C-33A, HaCaT and MRC-5 cells were determined with the 3-(4,5-dimethylthiazole-2-yl)-2,5-biphenyl tetrazolium bromide (MTT, Promega, Madison, WI, USA) [19]. Briefly, CaSki cells (1 × 104 per well) HeLa (2 × 104 per well), C-33A (2 × 104 per well), HaCaT (1.5 × 104 per well) and MRC-5 cells (4.5 × 104 per well) were seeded into 96-well culture plates and incubated for 12 h. Then, different concentrations of L17 were applied in duplicate and incubated for 48 h. 20 μl MTT (5 mg/ml) was added to each well and incubated for another 4 h, followed by solubilization in 150 μl DMSO (Promega) and spectrophotometric measurement at 490 nm on Enspire (Perkin Elmer, Waltham, MA, USA). The maximum non-toxic concentration was defined as the concentration that cell survival rate is greater than 90% (survival rate = absorbance of test group/absorbance of untreated controls).

Quantitative real-time reverse transcription PCR (qRT-PCR) analysis of HPV16 E6 and E7 transcripts

CaSki cells (6 × 105 per well) were seeded into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 12, 24, 36 and 48 h. Total cellular RNA was extracted with RNeasy Mini kit (Qia-gen, Germantown, MD, USA) according to the manufacturer’s protocol. The one-step quantitative RT-PCR (qRT-PCR) was conducted with the ABI 7500 Fast RT-PCR system (Applied Biosystems, Foster City, CA, USA) using SuperScript III Platinum SYBR Green One-step RT-PCR Kit (Invitrogen, Carlsbad, California, USA) with the following procedures: 50 °C for 3 min, 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30s [20]. The mRNA expression of HPV16 E6 was determined using primers (F: 5′-CTGCAATGTTTCAGGACCCA-3, R: 5′-TCATGTATAGTTGTGCAGCTCTGT-3′) targeting HPV-16 E6 open-reading frame. The mRNA expression of HPV16 E7 was determined using primers (F: 5′-GAGGAGGAGGATGAAATAGATGGT-3′,R: 5′-CACTTGCAACAAAACGTT ACAATATTG-3′) targeting HPV-16 E7 open-reading frame. β-actin was determined using primers (F: 5′- CCAACCGCGAGAAGATGA-3′, R: 5′- CCAGAGGCGTACAGGGATAG -3′). The ΔΔCt method was used to represent mRNA fold change [21].

Western blot analysis

CaSki cells (6 × 105 per well) and MRC-5 cells (5 × 105 per well) were seeded into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 48 h. After incubation, whole cell lysates of CaSki and MRC-5 cells were extracted with M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, Waltham, MA, USA). Nuclear fractions of CaSki cells were isolated with NE-PER nuclear and cytoplasmic extraction kit (Beyotime Biotechnology, Shanghai, China). The protein concentrations were determined by the BCA reagents (Thermo Fisher Scientific). The samples, containing 20 μg protein, were boiled for 10 min to denature and resolved on 12% (w/v) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels. Then the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Milli-pore, Billerica, MA, USA). Immunodetection was performed with HPV16-E6 antibody (1:500) (Santa Cruz, sc-460, mouse monoclonal antibody, Dallas, Texas, USA) [22], HPV16-E7 antibody (1:500) (Santa Cruz, sc-6981, mouse monoclonal antibody) [23], p53 antibody (1:1000) (BD Biosciences, San Diego, CA, USA), Rb antibody (1:1000) (BD Biosciences) and Histone H3 antibody (1:1000) (Cell Signaling Technology, Beverly, MA, USA), followed by incubation with HRP-conjugated antibody (1:5000) (Santa Cruz). β-actin (1:5000) (Cell Signaling Technology) was used as a normalization standard in whole cell lysate fractions. Histone H3 was used to normalize nuclear protein loading [20, 24].

Measurement of stability of HPV16 E6 and E7 mRNAs

RNA synthesis inhibitor actinomycin D (Sigma-Aldrich, St Louis, MO, USA) was used to determine the effect of L17 on the stability of HPV16 E6 and E7 mRNAs [25]. CaSki cells (6 × 105 per well) grown in 6-well plates were treated with or without L17 (40 μg/ml) for 4 h and then 5 μg/ml actinomycin D was added to 6-well plates. Cells were harvested at 0, 2, 4, 6 and 8 h post-actinomycin D treatment. Total cellular RNA was isolated with RNeasy Mini kit and qRT-PCR analyses of HPV16 E6 and E7 transcript levels were performed. HPV16 E6 and E7 transcript levels before actinomycin D treatment were determined as baselines in the experiment. Since mRNA degradation generally obeys first-order process, the slope for the correlation of E6, E7 mRNA level and time is the degradation constant Kd (lnC = lnC0 –Kdt, where C0 is the mRNA concentration at time zero) and the half-life of E6 and E7 mRNA was equal to 0.693/kd according to previously described method [25,26,27,28].

Measurement of HPV16 E6 and E7 protein stability

Translation inhibitor cyclohexamide (CHX, Sigma-Aldrich, USA) was used to determine the effect of L17 on the stability of HPV16 oncoproteins E6 and E7 [25, 29]. CaSki cells (6 × 105 per well) were treated with L17 (40 μg/ml) in the presence or absence of CHX (50 μg/ml). Cells were harvested at 0, 0.5, 1 and 2 h after CHX treatment, and then cell lysates were extracted for Western blot analysis. In all these experiments, HPV16 E6 and E7 protein levels before CHX treatment were determined as baseline.

Cell cycle analysis by flow cytometry

Flow cytometry analysis was performed to demonstrate the effect of L17 on cell cycle progression. CaSki cells (4 × 105 per well) and MRC-5 cells (4.5 × 105 per well) cells were plated into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 48 h. Then the cells were harvested and fixed in 70% ethanol at 4 °C for 12 h. Before flow cytometry analysis, cells were stained with 1 ml of PI (15 mg/ml) containing RNase (2.5 mg/ml) (Beyotime Biotechnology). DNA content was determined by a Coulter EPICS XL/XL-MCL Flow Cytometry System (Coulter Corp, Brea, California, USA) and the proportion of cells in a particular phase of cell cycle was determined by ModFitLT software.

Statistical analyses

All results were expressed as mean ± SD of data obtained from at least triplicate experiments using SPSS software. Statistical analysis was performed by using unpaired, two tailed Student’s t-test. All comparisons were made relative to controls and p < 0.05 was considered statistically significant.

Results

L17 inhibited the expression of E6 and E7 proteins in Caski cells

The chemical structure of L17 is shown in Fig. 1a. We first studied its effects on the viability of CaSki (human cervical cancer cells, HPV 16 positive), HeLa (human cervical cancer cells, HPV 18 positive), C-33A (human cervical cancer cells, HPV negative), HaCaT (Human keratinocyte cells, HPV negative) and the MRC-5 (human lung fibroblast cells, HPV negative). The results showed that the maximum non-toxic concentration of L17 in CaSki, HeLa, C-33A, HaCaT and MRC-5 were 40, 20, 20, 160 and 80 μg/ml, respectively (Fig. 1b).

Next, we studied the effects of L17 on the expression of HPV oncoproteins E6 and E7, which are associated with the development of cervical cancer. Our results showed that L17 down-regulated the expression of HPV E6 and E7 proteins in a dose-dependent manner in CaSki cells (Fig. 1c).

In order to determine how L17 decreased the level of HPV E6 and E7 proteins, we studied the effect of L17 on the stability of E6 and E7 proteins by using cyclohexamide (CHX), a potent translation inhibitor. Decreased stability of E6 protein was observed in presence of L17, whereas stability of E7 protein largely remained unaltered (Fig. 1d).

L17 enhanced degradation of E6 and E7 mRNAs

To examine the effect of L17 on the expression of HPV16 E6 and E7 mRNAs, CaSki cells treated with or without L17 were analyzed by qRT-PCR assay. The results showed that L17 decreased the expression of HPV16 E6 mRNA (Fig. 2a Left) and E7 mRNA (Fig. 2a Right) in a time-dependent and dose-dependent manner.

Fig. 2
figure 2

L17 enhanced the degradation of E6 and E7 mRNA. a L17 reduced the expression of E6 and E7 mRNA of CaSki cells by one-step qRT-PCR assay. *P < 0.05; **P < 0.01. b L17 enhenced the degradation of HPV16 E6 and E7 mRNA by one-step qRT-PCR assay

Full size image

In order to determine how L17 decreased the HPV16 E6 and E7 mRNA expression, we carried out experiments with actinomycin D, a potent transcription inhibitor. We observed that compound L17 reduced the transcript half-life time from approximately 7.0 h to 3.7 h for E6 (Fig. 2b Left) and from 5.3 h to 3.3 h for E7 (Fig. 2b Right), respectively.

L17 up-regulated p53 and Rb expression in CaSki cells

A number of genetic and biochemical studies have shown that p53 and Rb are the most important tumor suppressor proteins in keeping cells from immortalization and transformation [17, 30]. HPV oncoproteins E6 and E7 are known to cause the down-regulation of tumor suppressor proteins p53 and Rb, which is linked to the malignant proliferation of cells [13]. We thus examined the effect of L17 on the expression of p53 and Rb. The results demonstrated that L17 dose-dependently up-regulated p53 and Rb protein expressions in HPV-positive CaSki cells (Fig. 3a). Considering the fact that p53-mediated cell proliferation inhibition depends on its localization in the nucleus [31], it is necessary to examine the effect of L17 on p53 protein level in the nucleus of CaSki cells. We observed that L17 does-dependently increased p53 levels in the nucleus (Fig. 3a), which suggested that p53 exhibited a functional activation in the HPV-positive CaSki cells treated with L17. Interestingly, we found that L17 did not increase p53 and Rb proteins level in HPV-negtive MRC-5 cells (Fig. 3b). These results suggest that reduced expression of E6 and E7 is the key contributor to L17-mediated up-regulation of p53 and Rb.

Fig. 3
figure 3

The effect of L17 on the expression of p53 and Rb proteins. a L17 up- regulated the expression of total p53 and Rb proteins and p53 in nucleus of CaSki cells by Western blot assay. b L17 did not effect the expression of p53 and Rb proteins of MRC-5 cells by Western blot assay

Full size image

The effect of L17 on cell cycle progression

It has been shown that p53 and Rb played pivotal roles in the negative control of cell cycle progress. Next, we thus performed flow cytometry analysis of PI-stained cells to demonstrate the effect of L17 on cell cycle progression. In line with the increase of p53 and Rb expression in CaSki cells, our results revealed that L17 induced CaSki cells arrest at G0/G1 phase in a dose-dependent manner (Fig. 4a). Meanwhile, we didn’t observe obvious change of cell cycle in MRC-5 (Fig. 4b) treated with L17, which is in agreement with the finding that L17 had no effect on the levels of p53 and Rb in normal cells.

Fig. 4
figure 4

The effect of L17 on cell cycle progression. Flow cytometry analysis of CaSki (a) and MRC-5 (b) cells. Data represent as mean ± SD. *P < 0.05; **P < 0.01

Full size image

Discussion

In our previous study, we have shown that compounds of phenyl benzamide exerted a potent inhibitory action against influenza, EV71 and HCV [32,33,34]. Herein, we showed for the first time that L17, a novel derivative of phenyl benzamide, exerted a potent inhibitory action against HPV in CaSki cells. Given that persistent infection with high-risk HPVs is the major contributor to cervical cancer. Therefore, this study suggests that L17 might be a potential drug candidate or adjuvant to treat cervical cancer.

It is well established that the HPV oncoproteins E6 and E7 are the main contributors to cervical cancer. Our study demonstrated that L17 dose-dependently inhibited the expression of HPV E6 and E7 proteins in CaSki cells, which confirmed that L17 might have potential inhibitory activity against cervical cancer associated with HPV. Further research found that L17 could significantly decrease the stability of HPV16 E6, E7 mRNA and E6 protein, whereas the stability of E7 protein largely remained unaltered. The mechanisms underlying differential stability of E6 and E7 mRNA are still not understood in this study. It is known that the stability of mRNA is related to miRNA-mediated mRNA degradation, RNA binding proteins and the cell biological state [35,36,37,38]. Thus, we speculated that L17-mediated degradation of HPV mRNA might be associated with the changed expression of particular miRNAs targeting E6 and E7 mRNA. However, the exact reason for the decreased stability of E6 and E7 mRNA and protein needs further study.

It is reported that abrogating E6 and E7 function in neoplastic cells by targeting gene expression or protein-protein interaction could reactivate p53 and pRb expression, with subsequent restore cell growth control which includes cell cycle arrest and apoptosis [14,15,16,17]. In our study, we observed that L17 does-dependently increased the expression of p53 and Rb tumor suppressor proteins in the HPV16 positive cervical cancer cell line CaSki. At the same time, the tumor suppressor protein levels in the HPV negative cell lines MRC-5 largely remained unaltered. This suggests that L17 does not directly change p53 and Rb expression, and the up-regulation in CaSki is caused by the down-regulation of E6 and E7. The increased nuclear location of p53 in CaSki treated with L17 suggested that p53 had a functional activation. In addition, we found that L17 does-dependently induced G0/G1 phase arrest in CaSki cells, while had no effect on the cell cycle of MRC-5, which implies that the cell cycle arrest in CaSki by L17 is linked to p53 and Rb up-regulation. In spite of the restoration of p53 function, we did not observe obvious apoptosis in the experiment, which is at odds with other published observations [8, 31]. This probably links to the hypothesis that although L17 could repress the expression of E7 protein, the level of E7 protein in cells probably remains high enough to drive mitotic signals to block the p53-dependent apoptosis.

Human papillomaviruses (HPVs) are the primary causative agents for cervical cancer, and HPV oncoproteins E6 and E7 are known to be the main reason for the onset and maintenance of the malignancies. Our study suggested that L17 had potential action in preventing cervical cancer by reducing the expression of HPV16 E6 and E7 at both the mRNA and protein levels. Importantly, treatment with L17 rescued high levels of p53 and Rb tumoursuppressor proteins in HPV16-positive cervical cells, and then induced the cell cycle arrest at G0/G1phase. Of note, L17 had no effect on the expression of p53 and Rb and cell cycle in HPV-negative MRC-5. This suggested that L17 did not interfere with the proliferation of normal cells. Compared to direct anticancer drugs, L17 thus reveals a potential advantage of hypotoxicity against normal cell. However, it should be also noted that the lack of apoptosis induction might compromise the ability of L17 inhibition of growth in HPV positive cells.

Conclusion

In this study, we found that a compound L17 has antiviral activity through suppressing E6 and E7 oncogene expression and might be exploited as a candidate agent for HPV-associated cervical cancer prevention and treatment.

Abbreviations

CHX:

Cyclohexamide

HPVs:

Human papillomaviruses

HR:

High-risk

L17:

3-(2-Chloropropylamide)-4-methoxy-N- phenylbenzamide

MTT:

3-(4,5-dimethylthiazole-2-yl)-2,5-biphenyl tetrazolium bromide

PVDF:

Polyvinylidene fluoride

qRT-PCR:

quantitative real-time reverse transcription PCR

SDS-PAGE:

Sodium dodecyl sulfate polyacrylamide gel electrophoresis

References

  1. Schiffman M, Wentzensen N, Wacholder S, Kinney W, Gage JC, Castle PE. Human papillomavirus testing in the prevention of cervical cancer. J Natl Cancer Inst. 2011;103:368–83.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69–90.

    Article  PubMed  Google Scholar 

  3. Bodily J, Laimins LA. Persistence of human papillomavirus infection: keys to malignant progression. Trends Microbiol. 2011;19:33–9.

    Article  CAS  PubMed  Google Scholar 

  4. Crow JM. HPV: the global burden. Nature. 2012;488:S2–3.

    Article  PubMed  Google Scholar 

  5. Forman D, de Martel C, Lacey CJ, Soerjomataram I, Lortet-Tieulent J, Bruni L, Vignat J, Ferlay J, Bray F, Plummer M, Franceschi S. Global burden of human papillomavirus and related diseases. Vaccine. 2012;30(Suppl 5):F12–23.

    Article  PubMed  Google Scholar 

  6. Jimenez-Wences H, Peralta-Zaragoza O, Fernandez-Tilapa G. Human papilloma virus, DNA methylation and microRNA expression in cervical cancer (Review). Oncol Rep. 2014;31:2467–76.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Pogoda CS, Roden RB, Garcea RL. Immunizing against anogenital cancer: HPV vaccines. PLoS Pathog. 2016;12:e1005587.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Snoeck R. Papillomavirus and treatment. Antivir Res. 2006;71:181–91.

    Article  CAS  PubMed  Google Scholar 

  9. Hampson L, Martin-Hirsch P, Hampson IN. An overview of early investigational drugs for the treatment of human papilloma virus infection and associated dysplasia. Expert Opin Investig Drugs. 2015;24:1529–37.

    Article  CAS  PubMed  Google Scholar 

  10. Phelps WC, Barnes JA, Lobe DC. Molecular targets for human papillomaviruses: prospects for antiviral therapy. Antivir Chem Chemother. 1998;9:359–77.

    Article  CAS  PubMed  Google Scholar 

  11. Arbyn M, Kyrgiou M, Simoens C, Raifu AO, Koliopoulos G, Martin-Hirsch P, Prendiville W, Paraskevaidis E. Perinatal mortality and other severe adverse pregnancy outcomes associated with treatment of cervical intraepithelial neoplasia: meta-analysis. BMJ. 2008;337:a1284.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Moody CA, Laimins LA. Human papillomavirus oncoproteins: pathways to transformation. Nat Rev Cancer. 2010;10:550–60.

    Article  CAS  PubMed  Google Scholar 

  13. Narisawa-Saito M, Kiyono T. Basic mechanisms of high-risk human papillomavirus-induced carcinogenesis: roles of E6 and E7 proteins. Cancer Sci. 2007;98:1505–11.

    Article  CAS  PubMed  Google Scholar 

  14. Thomas M, Pim D, Banks L. The role of the E6-p53 interaction in the molecular pathogenesis of HPV. Oncogene. 1999;18:7690–700.

    Article  CAS  PubMed  Google Scholar 

  15. Jansen-Durr P. How viral oncogenes make the cell cycle. Trends Genet. 1996;12:270–5.

    Article  CAS  PubMed  Google Scholar 

  16. Munger K, Basile JR, Duensing S, Eichten A, Gonzalez SL, Grace M, Zacny VL. Biological activities and molecular targets of the human papillomavirus E7 oncoprotein. Oncogene. 2001;20:7888–98.

    Article  CAS  PubMed  Google Scholar 

  17. Accardi L, Dona MG, Mileo AM, Paggi MG, Federico A, Torreri P, Petrucci TC, Accardi R, Pim D, Tommasino M, et al. Retinoblastoma-independent antiproliferative activity of novel intracellular antibodies against the E7 oncoprotein in HPV 16-positive cells. BMC Cancer. 2011;11:17.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Maher DM, Bell MC, O'Donnell EA, Gupta BK, Jaggi M, Chauhan SC. Curcumin suppresses human papillomavirus oncoproteins, restores p53, Rb, and PTPN13 proteins and inhibits benzo[a]pyrene-induced upregulation of HPV E7. Mol Carcinog. 2011;50:47–57.

    Article  CAS  PubMed  Google Scholar 

  19. Sylvester PW. Optimization of the tetrazolium dye (MTT) colorimetric assay for cellular growth and viability. Methods Mol Biol. 2011;716:157–68.

    Article  CAS  PubMed  Google Scholar 

  20. Wang HQ, Meng S, Li ZR, Peng ZG, Han YX, Guo SS, Cui XL, Li YH, Jiang JD. The antiviral effect of 7-hydroxyisoflavone against Enterovirus 71 in vitro. J Asian Nat Prod Res. 2013;15:382–9.

    Article  CAS  PubMed  Google Scholar 

  21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 2001;25:402–8.

    Article  CAS  PubMed  Google Scholar 

  22. Li W, Anderson RA. Star-PAP controls HPV E6 regulation of p53 and sensitizes cells to VP-16. Oncogene. 2014;33:928–32.

    Article  CAS  PubMed  Google Scholar 

  23. Fan X, Chen JJ. Role of Cdk1 in DNA damage-induced G1 checkpoint abrogation by the human papillomavirus E7 oncogene. Cell Cycle. 2014;13:3249–59.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Cha MK, Lee DK, An HM, Lee SW, Shin SH, Kwon JH, Kim KJ, Ha NJ. Antiviral activity of Bifidobacterium adolescentis SPM1005-A on human papillomavirus type 16. BMC Med. 2012;10:72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Munagala R, Kausar H, Munjal C, Gupta RC. Withaferin A induces p53-dependent apoptosis by repression of HPV oncogenes and upregulation of tumor suppressor proteins in human cervical cancer cells. Carcinogenesis. 2011;32:1697–705.

    Article  CAS  PubMed  Google Scholar 

  26. Ross J. mRNA stability in mammalian cells. Microbiol Rev. 1995;59:423–50.

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Luczak MW, Jagodzinski PP. Apicidin down-regulates human papillomavirus type 16 E6 and E7 transcripts and proteins in SiHa cervical cancer cells. Cancer Lett. 2008;272:53–60.

    Article  CAS  PubMed  Google Scholar 

  28. Mellenthin M, Ellersiek U, Borger A, Baier M. Expression of the Arabidopsis sigma factor SIG5 is photoreceptor and photosynthesis controlled. Plants (Basel). 2014;3:359–91.

    Article  CAS  PubMed Central  Google Scholar 

  29. Jing K, Shin S, Jeong S, Kim S, Song KS, Park JH, Heo JY, Seo KS, Park SK, Kweon GR, et al. Docosahexaenoic acid induces the degradation of HPV E6/E7 oncoproteins by activating the ubiquitin-proteasome system. Cell Death Dis. 2014;5:e1524.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Bossi G, Sacchi A. Restoration of wild-type p53 function in human cancer: relevance for tumor therapy. Head Neck. 2007;29:272–84.

    Article  PubMed  Google Scholar 

  31. Abdulkarim B, Sabri S, Deutsch E, Chagraoui H, Maggiorella L, Thierry J, Eschwege F, Vainchenker W, Chouaib S, Bourhis J. Antiviral agent Cidofovir restores p53 function and enhances the radiosensitivity in HPV-associated cancers. Oncogene. 2002;21:2334–46.

    Article  CAS  PubMed  Google Scholar 

  32. Hao LH, Li YP, He WY, Wang HQ, Shan GZ, Jiang JD, Li YH, Li ZR. Synthesis and antiviral activity of substituted bisaryl amide compounds as novel influenza virus inhibitors. Eur J Med Chem. 2012;55:117–24.

    Article  CAS  PubMed  Google Scholar 

  33. Ji XY, Wang HQ, Hao LH, He WY, Gao RM, Li YP, Li YH, Jiang JD, Li ZR. Synthesis and antiviral activity of N-phenylbenzamide derivatives, a novel class of enterovirus 71 inhibitors. Molecules. 2013;18:3630–40.

    Article  CAS  PubMed  Google Scholar 

  34. Jiang Z, Wang H, Li Y, Peng Z, Li Y, Li Z. Synthesis and antiviral activity of a series of novel N-phenylbenzamide and N-phenylacetophenone compounds as anti-HCV and anti-EV71 agents. Acta Pharm Sin B. 2015;5:201–9.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Hao S, Baltimore D. The stability of mRNA influences the temporal order of the induction of genes encoding inflammatory molecules. Nat Immunol. 2009;10:281–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Sharova LV, Sharov AA, Nedorezov T, Piao Y, Shaik N, Ko MS. Database for mRNA half-life of 19 977 genes obtained by DNA microarray analysis of pluripotent and differentiating mouse embryonic stem cells. DNA Res. 2009;16:45–58.

    Article  CAS  PubMed  Google Scholar 

  37. Houseley J, Tollervey D. The many pathways of RNA degradation. Cell. 2009;136:763–76.

    Article  CAS  PubMed  Google Scholar 

  38. Hoen PA T, Hirsch M, de Meijer EJ, de Menezes RX, van Ommen GJ, den Dunnen JT. mRNA degradation controls differentiation state-dependent differences in transcript and splice variant abundance. Nucleic Acids Res. 2011;39:556–66.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

The work was supported by the Science Fund for Creative Research Groups of the National Natural Science Foundation of China (Grant 81,321,004). The work was also supported by the National Science and Technology Major Project of the Ministry of Science and Technology of China (2012ZX09301002–001-015) and CAMS Initiative for Innovative Medicine (CAMS-I2M-1-010).

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article.

Author information

Authors and Affiliations

  1. Institute of Medicinal Biotechnology, Chinese Academy of Medical Science & Peking Union Medical College, No 1, Tiantan Xili, Beijing, 100050, People’s Republic of China

    Fang Han, Yanping Li, Qiaoni Lu, Linlin Ma, Huiqiang Wang, Jiandong Jiang, Zhuorong Li & Yuhuan Li

  2. Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, No 1, Tiantan Xili, Beijing, 100050, China

    Jiandong Jiang

  3. Key Laboratory of Molecular Imaging of Shanghai Education Commission, Shanghai University of Medicine & Health Sciences, No 279, Zhouzhugong Road, Shanghai, 201318, People’s Republic of China

    Linlin Ma

Authors
  1. Fang Han
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yanping Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Qiaoni Lu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Linlin Ma
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Huiqiang Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Jiandong Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Zhuorong Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Yuhuan Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

FH and QNL designed and performed experiments, analyzed the data, and wrote the manuscript. YPL synthesised and provided the 3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide (L17) compound. LLM and HQW provided suggestions on coordinated the experimental design and helped to edit the manuscript. JDJ contributed to research design. YHL and ZRL contributed to research design, research data, and preparation of the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Zhuorong Li or Yuhuan Li.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Han, F., Li, Y., Lu, Q. et al. 3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide inhibits expression of HPV oncogenes in human cervical cancer cell. Virol J 14, 145 (2017). https://doi.org/10.1186/s12985-017-0806-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12985-017-0806-5

Keywords

Virology Journal

ISSN: 1743-422X