Skip to main content

Table 1 Sequences of the primers used in this study. The primers containing mixed nucleotides were designed for detection of both A/PR8 and A/WSN-derived RNAs. Influenza virus mRNAs utilise primers that are 10–13 nt in length and the predicted sizes of the mRNA fragments reflect this heterogeneity

From: Unexpected complexity in the interference activity of a cloned influenza defective interfering RNA

Target RNA Primer specificity Primer sequence Expected product Size/s (nt)
Seg 1-GFP c/mRNA GGACACGCTGAACTTGTGG 142/152–5
vRNA AGATAAGAGGATAATGGAAATG 242
DI 1/244 c/mRNA ATATGGTCCACKGTGGTTTTTG 110/120–3
vRNA GGAGAAGACTGAGGGGATTC 252
Segment 2 (PB1) c/mRNA* TCCATGGTGTATCCTGTTCC 146/156–9
vRNA* TGATTTCGAATCTGGAAGGA 134
Segment 3 (PA) c/mRNA* TGAGTGCATATTGCTGCAAAT 146/156–9
vRNA* TTCTTATCGTTCAGGCTCTT 213
Segment 6 (NA) c/mRNA* TCCAGTATGGTTTTGAYTTCCR 160/170–3
vRNA* TGGACTAGTGSGAGCATSAT 130
5S rRNA*   TCCCAGGCGGTCTCCCATCC 100
  1. * indicates primers taken from [50]