Skip to main content

Advertisement

Table 1 Primers used in this study

From: Interleukin-2 enhancer binding factor 2 interacts with the nsp9 or nsp2 of porcine reproductive and respiratory syndrome virus and exerts negatively regulatory effect on the viral replication

Primersa Sequence (5-3′)b Use
1F AGCTTTGTTTAAACCCATGTACCCATACGATGTTC pWPXL-nsp9 construction
1R CGACGCGTAACTCATGATTGGACCTGAG
2F ATGAGGGGGGACAGAGGCCGTG ILF2 gene amplification
2R TCACTCCTGAGTCTCCATG
3F CCGGAATTCGGATGAGGGGGGACAGAG pCMV-HA-ILF2/pCMV-Myc-ILF2 construction
3R CGGGGTACCTCACTCCTGAGTCTCCATG
4F AGCTTTGTTTAAACACCATGAGGGGGGACAGAG pWPXL-ILF2 construction
4R CGACGCGTAACTCCTGAGTCTCCATG
5F CGCGTCGACGGCCGGAAAGAGAGCAAGGA pCMV-HA-nsp2 construction
5R GAAGATCTTCATCCCCCTGAAGGCTTCGAA
6F AGCTTTGTTTAAACACCATGGCCGGAAAGAGAGCAAGG pWPXL-nsp2N construction
6R CGCGACGCGTAATGAAGTCGCCTGGGTGTTGGCTAG
7F AGCTTTGTTTAAACACCATGGGCAAGGACTCGGTCCCTCTG pWPXL-nsp2M construction
7R CGCGACGCGTAATTGGTCTAAGAGCCTTCCTGC
8F AGCTTTGTTTAAACACCATGGGCAAGGACTCGGTCCCTCTG pWPXL-nsp2C construction
8R CGCGACGCGTAATCCCCCTGAAGGCTTCGAAATTTGC
  1. aF denotes forward PCR primer; R denotes reverse PCR primer
  2. bRestriction sites are underlined