Skip to main content

Table 1 Primers and probes used in CaPV real-time RPA and CaPV RPA LFD assay

From: Development of real-time and lateral flow dipstick recombinase polymerase amplification assays for rapid detection of goatpox virus and sheeppox virus

Name Sequence (5′ –3′) Genome location (KF661979.1)
CaPV Fe1 CATTGTCTGATTTAATTTTCGTGTTGGTGTTTCCT 377–411
CaPV Fe2 CGTGTTGGTGTTTCCTTTTAATTTATACAATAGTA 396–430
CaPV Fe3 TGTTTCCTTTTAATTTATACAATAGTATAGCTAAA 404–438
CaPV Re1 ATCAATGTTATAAATGACATGCTATTGTAAAAACC 493–527
CaPV Re2 CAATAGCATGTCATTTATAACATTGATGAGTATTG 501–535
CaPV Re3 TATCTATCAATACTCATCAATGTTATAAATGACAT 508–546
CaPV Pe TAAACAATGGAGTTTGGGAGATTGTTTGTG(FAM- 435–486
  dT)A(THF)A(BHQ1-dT)TCAAAGCTATGTTTTAC-P  
CaPV Fn1 CATTGTCTGATTTAATTTTCGTGTTGGTGTTTCCT 377–411
CaPV Fn2 CGTGTTGGTGTTTCCTTTTAATTTATACAATAGTA 396–430
CaPV Fn3 TGTTTCCTTTTAATTTATACAATAGTATAGCTAAA 404–438
CaPV Rn1 Biotin-ATCAATGTTATAAATGACATGCTATTGTAAAAACC 493–527
CaPV Rn2 Biotin-CAATAGCATGTCATTTATAACATTGATGAGTATTG 501–535
CaPV Rn3 Biotin-TATCTATCAATACTCATCAATGTTATAAATGACAT 508–546
CaPV Pn FAM-AACAATGGAGTTTGGGAGATTGTTTGTGTA-THF-ATTCAAAGCTATGTTTTAC-P 435–486
  1. “e” and “n” were defined as RPA exo kit and RPA nfo kit respectively. The expected size of amplification products for each pair of primers were as following: CaPV F1/CaPV R1 (151 bp), CaPV F1/CaPV R2 (159 bp), CaPV F1/CaPV R3 (170 bp), CaPV F2/CaPV R1 (132 bp), CaPV F2/CaPV R2 (140 bp), CaPV F2/CaPV R3 (151 bp), CaPV F3/CaPV R1 (124 bp), CaPV F3/CaPV R2 (132 bp) and CaPV F3/CaPV R3 (143 bp)