Skip to main content

Advertisement

Table 3 Primer sets used for genetic characterization of mIBV and rIBV-wt

From: A reverse genetics system for avian coronavirus infectious bronchitis virus based on targeted RNA recombination

Primer set Target Primer Sequence (5′ ➔ 3′) Amplicon (bp)
A IBV 1a – IBV 1a IBV.F02 GGTGTAACACCAGAGATAAATG 1416
   IBV.R02 ATTTACGACGTCAAGAGCGTC  
B MHV 1b – MHV S 1173 GACTTAGTCCTCTCCTTGATTG 2479
   1127 CCAGTAAGCAATAATGTGG  
C IBV 1b – IBV S IBV.F73 TCAGCATGGACGTGTGGTTA 992
   IBV.R73 CCCCATGTAAATGCCAACCA  
D IBV S – IBV S IBV.F14 TAAATGGTGATCTTGTTT 708
   IBV.R13 CGCTCTTAGTAACATAAAC  
E IBV S – IBV M IBV.F15 TGCTGCTTCCTTTAATAAG 1994
   IBV.R15 CTGCGACAAGACCTCCTG  
F IBV 1b – MHV S mIBV.F47 TCAGCATGGACGTGTGGTTA 1035
   mIBV.R47 CCCAGGCCTTGTGAAACTTC  
G MHV S – MHV S MHV.F05 ACCCTCCGCTACTACGTTTT 966
   MHV.R05 AGGCAGGTATCATGTGACCA  
H MHV S – IBV M MHV.F08 GGATGGGTTTGATGCAACCA 2129
   IBV.R37 GAGAAAGCACCATTGGCACA  
  1. Primer set letters refer to Figs. 1 and 3