Skip to main content

Advertisement

Table 2 Primers used for SDM and cloning of the MHV spike and IBV nucleocapsid gene

From: A reverse genetics system for avian coronavirus infectious bronchitis virus based on targeted RNA recombination

Primer Sequence (5′ ➔ 3′) Function
XhoI-t-MHV-S.F01 CTCGAG TTATATTGGTGATTTTAGATGTATCCAG Cloning MHV S
MHV-S-StyI-XhoI.R01 CTCGAGCCAAGGCCATTTCACATACATTTC Cloning MHV S
p-MHV-S-SDM414.F02 AGCTTGTGAACTCAAACGGTG SDM EcoRI
p-MHV-S-SDM414.R02 GGATACATCTAAAATCACCAATATAAC SDM EcoRI
p-MHV-S-SDM2823.F03 TTACTATAAGTTCGAGACTGCC SDM XhoI
p-MHV-S-SDM2823.R03 CACCCTGCATTAATGCAC SDM XhoI
IBV-H52_N_ATG_FW ACCATGGCGAGCGGTAAGA N-transcript
IBV-M41-#2-IR-RV TTTTTTTTTTTTTTTTTTTGCTCTAACTCTATACTAG N-transcript
  1. XhoI restriction enzyme sites in sequences of primers XhoI-t-MHV-S.F01 and MHV-S-StyI-XhoI.R01 are in italics; an additional thymidine residue to keep the MHV spike gene ectodomain sequence in frame with the IBV spike gene signal sequence is in bold. SDM = site directed mutagenesis